Table S1 Microsatellite markers used in this study – primers and multiplexing combinations
Locus / Sequences / Florescence tag / Multiplexing / Annealing temperatureBg-B12 / F:GTCCAGCATGTTTTGCA / FAM / ABG / 60°C
R:GACATTTAGGAGAGTGGTCA
Bg-G7 / F:GCAGTACCATATCCTCAGGA / VIC
R:CCATGTTAGGTACCTTCAGA
Bg-A7 / F:AGCAACCTGTTAGGGGAGGA / NED
R:TGTGGCACGGATGGGAGA
Bg-C04 / F:ATTTGCAATACGGCCATCGA / FAM / CDD / 55°C
R:GGGAATAGAAGAGTGTGACA
Bg-D05 / F:AGGATGACGTCAAGGAACAA / PET
R:GGAATTGTGGCATAGCA
Bg-D9 / F:GGATCTGTGGATATCCCCTA / VIC
R:TACAAGAGCGATGAGTCTCA
Bg-F7 / F:TACCGGTTAGAGCGGGTGA / PET / DF / 48°C
R:ATCAAATTGGTCGCAGCGTA
Bg-1D5 / F:AATCACGAGTTGCCTACCAA / FAM
R:TTCAAGGTCCTCAACAGTCA
Table S2 Frequency of null alleles per population per locus calculated with GenePop. “Noinf” means “No information”.
SY01 / SY02 / BJ01 / BJ02 / BJ03 / BJ04 / BJ06 / XA01 / XA02 / XA03 / XA04 / CQ01 / CQ02 / CS01 / CS02 / NJ01 / NJ02 / NJ03 / NJ04 / SH01 / GZ01 / GZ02 / GZ03 / SZ01B12 / 0.1138 / 0.1597 / 0.1113 / 0.1018 / 0.1595 / 0.2117 / 0.3186 / 0.0125 / 0 / 0 / 0.0659 / 0.0376 / 0.1190 / 0.0043 / 0 / 0.0429 / 0 / 0.1094 / 0.0460 / 0 / 0 / 0.1342 / 0.0206 / 0.0246
G7 / 0.1558 / 0.1858 / 0.1123 / 0.0589 / 0.1386 / 0.2782 / 0.4556 / 0.1175 / 0.1043 / 0.1459 / 0.0942 / 0.0172 / 0.0836 / 0.0232 / 0 / 0.0301 / 0.0739 / 0.1999 / 0.1262 / 0.0165 / 0.1387 / 0.0838 / 0.0606 / 0
A7 / 0.0718 / 0.1347 / 0.1577 / 0.2165 / 0.1661 / 0.3973 / 0.3842 / 0.1082 / 0.0457 / 0.0167 / 0.0375 / 0.0853 / 0.0601 / 0 / 0.0267 / 0.2554 / 0.2417 / 0.0502 / 0.0463 / 0.1427 / 0.1452 / 0.0350 / 0 / 0.0910
D9 / 0.3782 / 0.3482 / 0.3522 / 0.3055 / 0.2335 / 0.1781 / 0.2407 / 0.3252 / 0.3425 / 0.2047 / 0.2887 / 0.2200 / 0.2817 / 0.2379 / 0.2027 / 0.2041 / 0.3355 / 0.2479 / 0.2573 / 0.2682 / 0.1824 / 0.1297 / 0.3111 / 0.1832
C04 / 0.1610 / 0.1579 / 0 / 0.1903 / Noinf / 0.1347 / 0.2016 / 0.2243 / 0.0554 / 0.2176 / 0.1193 / 0.2706 / 0 / 0.1593 / 0.2059 / 0.1454 / 0.1757 / 0 / 0 / 0.0837 / 0 / 0.0645 / 0.2229 / 0.2517
D05 / 0.0263 / 0.0107 / 0.1453 / 0.0917 / 0 / 0.2126 / 0.1444 / 0.0044 / 0.0849 / 0 / 0 / 0.0553 / 0.0909 / 0.0147 / 0.1058 / 0.1385 / 0.0734 / 0.0322 / 0 / 0.1511 / 0 / 0 / 0.0132 / 0.0485
1D5 / 0.1722 / 0.1718 / 0.1518 / 0.1379 / 0.0568 / 0.0979 / 0.1477 / 0.0732 / 0.1300 / 0.0273 / 0 / 0.0112 / 0.0374 / 0.0129 / 0.0098 / 0.1945 / 0.2868 / 0.0574 / 0.0859 / 0.1353 / 0.0234 / 0.0104 / 0.0770 / 0.0043
F7 / 0 / 0.0644 / 0 / 0 / 0.1198 / 0.0122 / 0.1469 / 0.0624 / 0 / 0.0056 / 0.0005 / 0 / 0 / 0 / 0 / 0 / 0.0454 / 0.0665 / 0 / 0.0636 / 0 / 0.0416 / 0 / 0
Table S3 P-value for each locus pair across all populations of genotypic linkage disequilibrium (Fisher's method) by Genepop
B12 / G7 / A7 / D9 / C04 / D05 / 1D5 / F7B12
G7 / 0.913861
A7 / 0.980435 / 0.402684
D9 / 0.870872 / 0.764896 / 0.157793
C04 / 0.694615 / 0.170104 / 0.899062 / 0.133247
D05 / 0.496161 / 0.681713 / Highly sign. / Highly sign. / 0.187725
1D5 / Highly sign. / 0.688491 / 0.943809 / 0.985146 / 0.036458 / Highly sign.
F7 / 0.747953 / 0.192591 / 0.655265 / 0.665462 / 0.276315 / Highly sign. / Highly sign.
Table S4 Summary of Analysis of Molecular Variance (AMOVA)
Source / df / SS / MS / Est. Var. / %Among Poplations / 23 / 342.913 / 14.909 / 0.227 / 7%
Among Individuals / 575 / 2066.730 / 3.594 / 0.757 / 25%
Within Individual / 599 / 1246.500 / 2.081 / 2.081 / 68%
Total / 1197 / 3656.143 / 3.064 / 100%
Note: df is the degrees of freedom; SS is the sum of squares; MS is the mean squares; Est. Var. is the estimated variance
SY01 / 0 / * / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
SY02 / 0.0144 / 0 / *** / *** / *** / *** / *** / *** / ** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
BJ01 / 0.0762 / 0.0535 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
BJ02 / 0.0289 / 0.0322 / 0.0638 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
BJ03 / 0.1014 / 0.1212 / 0.1752 / 0.1112 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
BJ04 / 0.0308 / 0.048 / 0.0735 / 0.0506 / 0.0899 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
BJ06 / 0.0548 / 0.0503 / 0.0723 / 0.0622 / 0.1592 / 0.0388 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
XA01 / 0.0273 / 0.0616 / 0.1128 / 0.075 / 0.1511 / 0.058 / 0.0819 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
XA02 / 0.0462 / 0.0162 / 0.0859 / 0.0773 / 0.1723 / 0.0824 / 0.0658 / 0.091 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
XA03 / 0.0937 / 0.0536 / 0.1104 / 0.0968 / 0.1545 / 0.0881 / 0.1328 / 0.1316 / 0.0968 / 0 / NS / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
XA04 / 0.0818 / 0.0393 / 0.0817 / 0.0815 / 0.1538 / 0.0706 / 0.0962 / 0.1049 / 0.0774 / 0.0013 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
CQ01 / 0.0581 / 0.0375 / 0.0909 / 0.0716 / 0.1749 / 0.0851 / 0.0821 / 0.0636 / 0.0571 / 0.1068 / 0.0695 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
CQ02 / 0.0438 / 0.0444 / 0.112 / 0.063 / 0.1665 / 0.0569 / 0.0661 / 0.0718 / 0.0745 / 0.1273 / 0.1016 / 0.0545 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
CS01 / 0.0693 / 0.0502 / 0.0251 / 0.0717 / 0.2127 / 0.0844 / 0.0524 / 0.0978 / 0.0599 / 0.144 / 0.1033 / 0.0641 / 0.0751 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / *** / ***
CS02 / 0.0719 / 0.0335 / 0.0818 / 0.0842 / 0.2076 / 0.0938 / 0.0596 / 0.0893 / 0.0585 / 0.1213 / 0.0797 / 0.0396 / 0.0578 / 0.0325 / 0 / *** / *** / *** / *** / *** / *** / *** / *** / ***
NJ01 / 0.0468 / 0.0373 / 0.0939 / 0.0788 / 0.1559 / 0.0606 / 0.0868 / 0.0907 / 0.0662 / 0.1068 / 0.0927 / 0.0824 / 0.0714 / 0.0876 / 0.0712 / 0 / NS / *** / * / *** / *** / *** / *** / ***
NJ02 / 0.0328 / 0.029 / 0.0818 / 0.0595 / 0.1473 / 0.0386 / 0.0612 / 0.0821 / 0.0615 / 0.1031 / 0.0871 / 0.088 / 0.0585 / 0.0756 / 0.0642 / 0.004 / 0 / *** / * / *** / *** / *** / *** / ***
NJ03 / 0.0353 / 0.0271 / 0.0844 / 0.0651 / 0.1358 / 0.0453 / 0.0508 / 0.0624 / 0.0579 / 0.0961 / 0.0739 / 0.0748 / 0.0474 / 0.0803 / 0.0557 / 0.0275 / 0.0202 / 0 / *** / *** / *** / *** / *** / ***
NJ04 / 0.0465 / 0.0365 / 0.0825 / 0.0788 / 0.1671 / 0.0603 / 0.0745 / 0.0787 / 0.0646 / 0.1169 / 0.091 / 0.081 / 0.058 / 0.0723 / 0.053 / 0.0029 / 0.0079 / 0.0156 / 0 / *** / *** / *** / *** / ***
SH01 / 0.0466 / 0.0488 / 0.0955 / 0.069 / 0.1589 / 0.0634 / 0.0706 / 0.0776 / 0.085 / 0.1479 / 0.123 / 0.0676 / 0.0644 / 0.0777 / 0.09 / 0.0747 / 0.0659 / 0.0644 / 0.0699 / 0 / *** / *** / *** / ***
GZ01 / 0.0491 / 0.0445 / 0.1142 / 0.0767 / 0.174 / 0.0977 / 0.0841 / 0.0824 / 0.0786 / 0.1529 / 0.1405 / 0.0802 / 0.0608 / 0.0919 / 0.0821 / 0.0749 / 0.0594 / 0.0512 / 0.0704 / 0.0422 / 0 / *** / *** / ***
GZ02 / 0.0472 / 0.0261 / 0.0612 / 0.0395 / 0.17 / 0.0752 / 0.0589 / 0.0832 / 0.0452 / 0.1141 / 0.0962 / 0.0559 / 0.0548 / 0.0381 / 0.0595 / 0.0717 / 0.056 / 0.0644 / 0.0702 / 0.0521 / 0.0304 / 0 / *** / ***
GZ03 / 0.0885 / 0.057 / 0.1178 / 0.0952 / 0.2344 / 0.1283 / 0.0838 / 0.1166 / 0.059 / 0.1243 / 0.1045 / 0.0582 / 0.0779 / 0.064 / 0.0487 / 0.0991 / 0.0871 / 0.0871 / 0.0977 / 0.0978 / 0.0849 / 0.0495 / 0 / ***
SZ01 / 0.0276 / 0.023 / 0.0521 / 0.0501 / 0.1451 / 0.0409 / 0.044 / 0.0523 / 0.0507 / 0.0943 / 0.067 / 0.0309 / 0.0497 / 0.0274 / 0.0355 / 0.0333 / 0.0245 / 0.0308 / 0.0331 / 0.0429 / 0.0446 / 0.0259 / 0.0496 / 0
Table S5 Pairwise Fst value and significance of differentiation. Lower diagonal is the pairwise Fst value, upper diagonal is the significance of the population differentiation.
Significant code(p value): 0 ‘***’ 0.001 ‘**’ 0.005 ‘*’ 0.01 ‘·’ 0.1 ‘NS’ 1
Table S6 Detailed statistics for the Mantel correlogram of isolation by distance of the German cockroach populations in China
Ln(km) / number of samples / Mantel correlation / p (Mantel) / p (corrected)Distance class 1 / 0.7003 / 4 / 0.033 / 0.299 / 0.299
Distance class 2 / 2.2677 / 28 / 0.0512 / 0.288 / 0.576
Distance class 3 / 3.835 / 30 / 0.1221 / 0.014 / 0.042
Distance class 4 / 5.4024 / 8 / 0.0257 / 0.412 / 0.864
Distance class 5 / 6.9698 / 482 / -0.1346 / 0.006 / 0.03
Fig. S1 Comparison of (a) number of alleles (Na, p = 0.0032256) and (b) observed heterozygosity (Ho, p = 0.0019467) between populations in North and in South.
Fig. S2 Results of the Delta K test by STRUCTURE Harvester. (a) Delta K test with STRUCTURE assignments of 24 predefined populations listed as in Table S1. (b) Delta K test with STRUCTURE assignments of 9 predefined populations as individuals from each city considered one population.