Uchida et al, HIV for human and rhesus cellsPage 1 of 6

Supplementary methods

Plasmid construction

The 4.3kb EcoRI – NotI fragment of the pCRV1/stHIVGagpol plasmid was treated by the DNA Polymerase I, Large Fragment (Klenow) (New England Biolabs, Ipswich, MA), and then it was inserted between the EcoRI and EcoNI sites of pCAG-KGP1.1R plasmid which was treated by Klenow , to construct the pCAG-stHIVgagpol plasmid.

The SIV+hCA (pCAG-SIVgprre-hCA plasmid) was produced by PCR, in which sCA gene of the SIV-Gag/Pol plasmid (pCAG-SIVgprre) was changed to the hCA gene. The hCA sequence (product 1) was amplified from the HIV1-Gag/Pol plasmid (pCAG-KGP1.1R) using the hCAF primer (5’-AATTACCCTATAGTGCAGAACATCCAG-3’) and the hCAR primer (5’-TGCTTTTAAAATAGTCTTACAATCTGGGTTCGC-3’). On the other hand, the SIV-Gag sequences outside of sCA were amplified from the HIV1-Gag/Pol plasmid using the sGagF primer (5’-ACACCTAGTGGTGGAAACAG-3’) and the sGag+hCAR primer (5’-GCCCCTGGATGTTCTGCACTATAGGGTAATTTCCTCCTCTGCCGCTAGATG-3’) for the upstream of the sCA (product 2), or the sGag+hCAF primer (5’-GCGAACCCAGATTGTAAGACTATTTTAAAAGCACTGGGAGTGAATCCCACCCTAGAAG3’-) and the sGagR primer (5’-AGGGCCTCTTTCAGGGCTTC-3’) for the downstream of the sCA (product 3). The sGag+hCAR primer and the sGag+hCAF primer included each ends of hCA as the 5’ site of the primers (underline). There were about 30 bases of overlaps between one end of the product 1 and 2, and between the other end of the product 1 and 3. The product 1 was combined with the product 2 by PCR reaction (product 4) using the sGagF primer and the hCAR primer with templates of the product 1 and 2, while the product 1 was combined with the product 3 (product 5) containing the hCAF primer and the sGagR primer with the product 1 and 3. Finally, the fragment of hCA franked with SIV-Gag sequence (product 6) was produced by the sGagF primer and the sGagR primer with the product 4 and 5. The product 6 was digested by restriction enzymes of DraIII and EcoNI, and then was exchanged into the DraIII - EcoNI site of the pCAG-SIVgprre plasmid, to construct the pCAG-SVIgprre-hCA plasmid.

The NciI – BsrDI fragment including the SIV-Vif sequence originated from SIVmac1A11 was treated by Klenow and it was inserted between the SmaI and XhoI sites of the pCL20csEF1-DsRedExp plasmid treated by Klenow, to construct pCL20c sEF1-sVif. The 1.5kb RcoRV – HindIII fragment (the SIV-Vif expression cassette under the control of the EF1 promoter) of the pCL20c sEF1 sVif plasmid was treated by Klenow and it was inserted backward into the HincII site of HIV1-Rev/Tat plasmid (pCAG4-RTR2) treated by Klenow, to construct a plasmid that expressed both HIV1-Rev/Tat and SIV-Vif (pCAG4-RTR2 sEF1-sVif) (Figure 1). In the same way, we constructed plasmids which expressed SIV-Rev/Tat and HIV1-Vif (pCAG4-RTR-SIV sEF1 hVif). The EcoRI – EcoRI fragment including HIV1-Vif sequence originated from HIV1 M:B_HXB2R was treated by Klenow and it was inserted between the SmaI and XhoI sites of the pCL20csEF1-DsRedExp plasmid treated by Klenow, to construct pCL20c sEF1-hVif. The 1.8kb EcoRV – HindIII fragment (the HIV1-Vif expression cassette under the control of the EF1 promoter) of the pCL20c sEF1 hVif plasmid was treated by Klenow and it was inserted backward into the HincII site of SIV-Rev/Tat plasmid (pCAG4-RTR-SIV) treated by Klenow, to construct a plasmid that expressed both SIV-Rev/Tat and HIV1-Vif (pCAG4-RTR-SIV sEF1-hVif).

Southern blot analysis

30g total DNA extracted from whole white blood cells were digested by HincII (single cutter) to evaluate dominant clones, or BglII (double cutter) and PstI (EYFP-sensitive) to evaluate vector integration into genomic DNA (Supplementary figure 2A). The signals were detected by the RRE probe (the 770b MfeI-HpaI fragment form pCL20c MpGFP) using chemifluorescent reactions (AlkPhos Direct™ Labeling and Detection Systems; GE Healthcare, Piscataway, NJ).

Real time PCR

EGFP and EYFP signals were separately detected by specific forward primers (qGFP-f;5’-CTGGCCCACCCTCGTGACCACCC-3’, qYFP-f; 5’-TGGCCCACCCTCGTGACCACCT-3’) and probes (qGFP-p; 5’-FAM-GACCTACGGCGTGCAGTGCTTCAG-TAMRA-3’, qYFP-p; 5’-FAM-CGGCTACGGCCTGCAGTGCTTCGC-TAMRA-3’), and an identical reverse primer (qGFP/YFP-r; 5’-CGGGTCTTGTAGTTGCCGTCGTC-3’) under the thermal cycle condition of 30 seconds in 95C, 30 seconds in 60C, and 15 seconds in 72C. TaqMan Ribosomal RNA control reagents (Applied Biosystems, Foster City, CA) were used to determine the amount of genomic DNA.

Surface marker analysis

To evaluate EGFP and EYFP expression among various lineages, allophycocyanin (APC)-colored antibodies were used (CD3-APC, clone10D12; CD20-APC, clone L27; CD33-APC, clone AC104.3E3; CD34, clone 563; CD41a-APC, clone HIP8; CD56-APC, clone AF12-7H3; CD71-APC, clone L01.1; RBC, clone T3G6; mouse IgG1-APC, clone X56). Three color signals were detected by FACSCalibur (BD Biosciences)

Supplementary Figure Legend

Supplementary figure 1. Complete blood counts (CBCs) following the transduced hematopoietic stem cell transplantation in 2 rhesus macaques

CBCs were monitored following the transduced hematopoietic stem cell transplantation. Transplanted cells engrafted on day9 in the first animal (A) and on day12 in the second animal (B). After engraftment, CBCs recovered to the normal ranges and they remained stable in both animals. Hb, hemoglobin; Plt, platelet; WBC, white blood cell.

Supplementary figure 2. Integration analysis of peripheral blood cells after transplantation

(A). HincII (single cutter) was used to evaluate dominant clones, and BglII (double cutter) and PstI (EYFP-sensitive) were used to evaluate vector integration into genomic DNA. The signals were detected by the RRE probe. After digestion with BglII and PstI, the HIV-EGFP vector and HIV1-EYFP vector signals could be separately detected as 3.2kb and 2.6kb bands, respectively. (B). After HincII digestion, no dominant clone was detected by Southern blot analysis of peripheral blood cells in the first animal. After BglII and PstI digestion, the EGFP signal was detected in peripheral blood cells, while there was no EYFP signal, suggesting the integrated copy number of the HIV1-EYFP vector was too low. RRE, Rev response element;Mp, MSCV-LTR U3 promoter; Blood cells, genomic DNA extracted from rhesus white blood cells; HeLa, genomic DNA of HeLa cell line; HeLa+GFP, HeLa DNA adding the EGFP plasmid; HeLa+YFP, HeLa DNA adding the EYFP plasmid.

Supplementary figure 3. Surface marker analysis of transgene expression among peripheral blood and bone marrow cells

Surface marker analysis of peripheral blood cells and bone marrow cells in the first animal demonstrated that the HIV vector yielded superior transduction rates compared to the HIV1 vector in all lineage cells.