Lab one—DNA coding

Lab Objective: To assist you in understanding the important nature of coding and anti-coding in DNA and RNA.

Items needed:

Patience

one pencil

few pieces of paper

two pieces of red or black licorice

Procedure:

There are three sentences below that need to transcribed, then translated. Just like in protein synthesis within the cell, transcription of the DNA into messenger RNA then into protein at the end in the ribosome, we will try to translate these sentences into something that makes sense.

Take the following sentence to start with:



Pretty tough huh? What if someone in your lab discovered that  means the letter “E”. Does that help? Remember, step by step we need to study what we know, not what we don’t. Just like playing hangman, we know that the sentence reads as follows:

_ _e ______e _ _ _ _ _ee

Still not much help? Well that is scientific discovery in a nut shell for you—we only know a little piece of the truth and we must keep on looking for the truth. Just then someone else at another lab discovers another part of the code.  means the letter “T”. Well that should help a lot, right? Let’s see, fill in the proper blanks above. How’s that? You may have figured out the code above, it should read the truth shall make you free. Well that was one code that you solved what about this one.



You keyboarding experts should know this one well. Hint: all twenty-six letters of our alphabet are in this puzzle using the same codes as above

Within our bodies there are 20 amino acids coded by just four letters a, g, c, and u: you know these as the nucleic acids adenine, guanine, cytosine, and uracil. These four nucleic acids code for all the amino acids that join to form every protein your body and other organisms use in their existence.

For your last challenge in coding and decoding for proteins, let’s do one that has some meaning. If the DNA strand that codes for hair on your toenail looks like the following, TACAAGATTCGCGTAATGCTAATCGAGATTTAA, what would the amino acids be in the resulting structure? Use the chart on page 211 in your text to figure out what amino acids exist in this polypeptide.

Now that you have used up all that glucose in making your brain work, take the two licorice and hold them together, side by side. Hold the ends of the licorice together and twist the ends in opposite directions. You have just created a double helix. Now imagine that the phosphate groups and the sugars (the old deoxyribose) are the licorice whips, and the space between the two is where you would find the nucleic acids. Now is the time for DNA destruction, yes, you may now eat the licorice.

Assignment:

1. What does the second code say?

2. What amino acids does the DNA (you have to translate them into mRNA first) above code for?