IS Notes Protein Synthesis-Transcription and Translation

IS Notes Protein Synthesis-Transcription and Translation

The Central Dogma

______à______à______

What’s so special about proteins?

•  “Life” = ______reactions

•  Chemical reactions in the body are made ______by proteins called ______.

•  Proteins are responsible for many body process such as helping the body ______, determining physical features such as hair and eye color, fighting against disease and carrying ______to our cells.

Transcription and Translation:
An Overview (The Central Dogma)

RNA vs. DNA

RNA / DNA

Transcription

•  Turns DNA sequence into ______

•  RNA forms base pairs with DNA

–  ______bonds to ______

–  ______bonds to ______(Thymine is replaced by Uracil)

•  Primary transcript- length of ______that results from the process of transcription

•  DNA turns to mRNA in the ______of the cell.

DNA=ACGATACCCTGACGAGCGTTAG

mRNA=UGCUAUGGGACUCUCGCAAUC

•  The message in DNA is “______”

into mRNA language

Major players in transcription

•  ______- (the m is for messenger): the type of RNA made from the DNA strand that carries information for the synthesis of proteins and carries it to a ribosome from the nucleus

•  ______- complex of enzymes with 2 functions:

•  Unwind DNA sequence

•  Produce ______by stringing together the chain of RNA nucleotides

Transcription is done…what now?

Now we have mature mRNA transcribed from the cell’s DNA. It leaves the nucleus through a ______. Once in the cytoplasm, it finds a ribosome so that ______can begin.

•  We know how mRNA is made, but how do we “read” the code?

Translation

•  ______stage of protein production

•  mRNA is on a ______

•  ______brings amino acids to the ribosome

by matching the “codon” on the mRNA

with the anticodon on the tRNA.

tRNA Function

•  Amino acids must be in the correct order for the protein to function correctly

•  tRNA lines up amino acids using ______code

Reading the DNA code

•  Every 3 ______bases pair with 3 ______bases

•  Every group of 3 mRNA bases encodes a single ______

•  ______- coding triplet of mRNA bases

•  ______-complimentary to the mRNA codon found on the tRNA

Protein Structure

•  Made up of ______

•  ______(protein)- string of amino acids

•  20 amino acids are arranged in different orders to make a variety of proteins

•  Assembled on a ribosome

Which codons code for which amino acids?

•  ______- inventory of linkages between nucleotide triplets and the amino acids they code for

•  A gene is a segment of DNA that brings about transcription of a segment of RNA

Transcription / Translation