Supplementary Table 1: Sequences of Primers used in Real-Time RT-PCR Analysis
Target Gene / Primer / SequencePAI-I / Forward / ACGTGGTTTTCTCACCCTATGG
Reverse / CATGCCCTTGTCATCAATCTTG
TRAIL / Forward / GGTCCTCAGAGAGTAGCAGCT
Reverse / CCTTTTCATTCTTGGAGTTTGG
TIMP-1 / Forward / TCCCTGTTTATCCATCCCCTG
Reverse / TTTTCAGAGCCTTGGAGGAG
RND3 / Forward / GGAGGCGCGGTGAGGAGT
Reverse / AACGCGGCGCAGACGAG
b-actin / Forward / CAGGCACCAGGGCGTG
Reverse / GCCCACATAGGAATCCTTCTGA
Supplementary Table 2. cDNA array analysis of all genes, standardized to the housekeeping gene β-actin and grouped according to function, showing differential expression in CFLD patients with Scheuer Fibrosis Stage F0, F1-2 (moderate fibrosis) and F3-4 (advanced) fibrosis compared to Controls. (ND - Not Detected)
Prot
Genes Associated with Fibrogenesis and Fibrolysis
(a). Collagens
collagen 4 alpha 6 subunit precursor (COL4A6) / 0.19 / ND / ND / D21337; U04845 / C120 / 1288 / Q14031
procollagen 1 alpha 2 subunit precursor (COL1A2) / 0.19 / 3.53 / 1.80 / X55525; J03464 / C192 / 1278 / P08123 P02464
procollagen 2 alpha 1 subunit precursor (COL2A1)(primary osteoarthritis, spondyloepiphyseal dysplasia, congenital) / 0.38 / 0.59 / 0.90 / X16468 / C190 / 1280 / P02458
procollagen 3 alpha 1 subunit precursor (COL3A1)(Ehlers-Danlos syndrome type IV, autosomal dominant) / 1.08 / 1.18 / 5.10 / X14420 / C188 / 1281 / P02461
collagen 4 alpha 2 subunit precursor (COL4A2) / 1.35 / ND / 0.90 / X05610 / C185 / 1284 / P08572
collagen 4 alpha 3 subunit precursor (COL4A3) (Goodpasture antigen) / 0.95 / 0.59 / 0.90 / M92993; X80031 / C161 / 1285 / Q01955
collagen 9 alpha 1 subunit precursor (COL9A1) / 1.42 / ND / 0.90 / X54412 / C191 / 1297 / P20849
collagen 6 alpha 1 subunit (COL6A1) / 1.07 / 0.39 / 1.20 / X15879 / C87 / 1291 / Q14041
collagen 6 alpha 2 subunit (COL6A2) / 1.42 / ND / 0.90 / M34570 / C31 / 1292 / Q13909 Q13911
collagen 6 alpha 3 subunit (COL6A3) / 1.17 / ND / 0.90 / X52022 / C90 / 1293 / P12111
collagen 8 alpha 1 subunit (COL8A1) / 2.00 / ND / 1.00 / X57527 / C94 / 1295 / P27658
collagen 11 alpha 1 subunit precursor (COL11A1) / 2.84 / ND / 1.00 / J04177 / C130 / 1301 / P12107
collagen 11 alpha 2 subunit (COL11A2) / 1.03 / ND / 1.35 / U32169 / C173 / 1302 / P13942
collagen 16 alpha 1 subunit precursor (COL16A1) / 0.41 / ND / 0.90 / M92642 / C48 / 1307 / Q07092
collagen 18 alpha 1 subunit (COL18A1) / 0.07 / 1.47 / 1.50 / L22548 / C17 / 80781 / P39060
(b). Matrix Metalloproteinases and Inhibitors
matrix metalloproteinase 1 (MMP1); interstitial collagenase precursor (CLG); fibroblast collagenase / 0.16 / 0.79 / 0.90 / X05231 / C283 / 4312 / P03956
matrix metalloproteinase 2 (MMP2); 72-kDa gelatinase A; 72-kDa type IV collagenase precursor / 2.00 / 1.18 / 2.70 / J03210; J05471 / C129 / 4313 / P08253
matrix metalloproteinase 3 (MMP3); stromelysin 1 precursor (STMY1; SL1); transin 1 / 0.53 / ND / 2.00 / X05232 / C320 / 4314 / P08254
Protein/gene / Stage 0 / Stage 1-2 / Stage 3-4 / Genbank / GENE ID / Locus Link / Swiss
Prot
matrix metalloproteinase 7 (MMP7); matrilysin / 0.95 / ND / 0.90 / X07819 / C85 / 4316 / P09237
matrix metalloproteinase 8 (MMP8); neutrophil collagenase precursor (CLG1); PMNL collagenase (PMNL-CL) / 0.69 / 0.71 / 1.80 / J05556 / C133 / 4317 / P22894
matrix metalloproteinase 9 (MMP9); gelatinase B; 92-kDa type IV collagenase precursor (CLG4B) / 0.88 / ND / 1.80 / J05070; D10051 / C132 / 4318 / P14780
matrix metalloproteinase 10 (MMP10); stromelysin 2 precursor (STMY2; SL2); transin 2 / 2.00 / ND / ND / X07820; M30461 / C322 / 4319 / P09238
matrix metalloproteinase 11 (MMP11); stromelysin 3 / 2.36 / 0.29 / 0.90 / X57766 / C95 / 4320 / P24347
matrix metalloproteinase 12 (MMP12); metalloelastase / 0.57 / ND / 0.90 / L23808 / C305 / 4321 / P39900
matrix metalloproteinase 13 (MMP13); collagenase 3 precursor / 0.47 / 0.59 / 0.90 / X75308 / C205 / 4322 / P45452
matrix metalloproteinase 14 precursor (MMP14); membrane-type matrix metalloproteinase 1 (MT-MMP1); MMP-X1 / 0.35 / 2.36 / 2.70 / D26512; X83535 / C121 / 4323 / P50281
matrix metalloproteinase 15 (MMP15); membrane-type matrix metalloproteinase 2 (MT-MMP2) / 0.53 / ND / 1.80 / Z48482 / C219 / 4324 / P51511
matrix metalloproteinase 16 precursor (MMP16); membrane-type matrix metalloproteinase 3 (MT-MMP3); MMP-X2 / 1.27 / ND / 1.35 / D50477 / C125 / 4325 / P51512
matrix metalloproteinase 17 (MMP17); membrane-type matrix metalloproteinase 4 (MT-MMP4) / 0.84 / 0.29 / ND 2.33 / X89576 / C110 / 4326 / Q14850
matrix metalloproteinase 18 (MMP18) + MMP19 / 0.55 / 0.59 / 1.80 / Y08622 + X92521 / C262 / 4327 / Q99580 Q99542
metalloprotease/disintegrin/cysteine-rich protein precursor (MDC9) / 1.46 / 0.94 / 1.80 / U41766 / C358 / 8754 / Q13443
metalloproteinase inhibitor 1 precursor TIMP1); erythroid potentiating activity (EPA); fibroblast collagenase inhibitor / 1.50 / 0.39 / 0.56 / X03124 / C83 / 7076 / P01033
tissue inhibitor of metalloproteinases 2 (TIMP2); metalloproteinase inhibitor 2 precursor; CSC-21K / 0.88 / 0.98 / 1.54 / J05593 / C245 / 7079 / Q99727
metalloproteinase inhibitor 3 precursor; tissue inhibitor of metalloproteinases 3 (TIMP3); mitogen-inducible gene 5 (MIG5) / 0.69 / 1.54 / 0.90 / Z30183 / C352 / 682 / P35613
tissue inhibtor of mettaloproteinase 4 (TIMP4) / ND / ND / ND / U76456 / C245 / 7079 / Q99727
Protein/gene / Stage 0 / Stage 1-2 / Stage 3-4 / Genbank / GENE ID / Locus Link / Swiss
Prot
basigin precursor (BSG); leukocyte activation antigen M6; collagenase stimulatory factor; extracellular matrix metalloproteinase inducer (EMMPRIN); 5F7; CD147 antigenbasigin (OK blood group) / 1.39 / 2.82 / 2.18 / L20471 / C352 / 682 / P35613
(c). Glycoproteins
fibronectin precursor (FN) / 0.72 / 1.39 / 2.20 / X02761; K00799; K02273; X00307; X00739 / C82 / 2335 / P02751 Q14326
laminin alpha 4 subunit precursor (laminin A4; LAMA4) / 0.71 / 0.67 / 1.35 / X70904; X91171 / C100 / 3910 / Q14731
laminin beta 2 subunit precursor (laminin B2; LAMB2); S-laminin / 2.17 / ND / 2.00 / S77512 / C168 / 3913 / P55268 Q16321
laminin gamma 2 subunit precursor (LAMC2) / 1.51 / ND / 0.90 / Z15009 / C216 / 3918 / Q13753
laminin beta 1 subunit precursor (laminin B1; LAMB1) / 1.00 / 1.33 / 2.00 / M61916 / C157 / 3912 / P07942
laminin gamma 1 subunit precursor (LAMC1); laminin B2 subunit (LAMB2) / 0.63 / 0.24 / 0.90 / J03202 / C128 / 3915 / P11047
40S ribosomal protein SA (RPSA); 34/67-kDa laminin receptor (LAMR1); colon carcinoma laminin-binding protein; NEM/1CHD4 / 0.56 / 0.91 / 0.49 / U43901 / C71 / 3921 / P08865
netrin-2 / 1.58 / ND / ND / U86759 / C255 / 4917 / O00634
nidogen precursor (NID); entactin / ND / 0.17 / 0.60 / M30269 / C27 / 4811 / P14543 Q14942
secreted protein acidic and rich in cysteine precursor (SPARC); osteonectin (ON); basement membrane protein (BM40) / 0.68 / 0.92 / 1.64 / J03040 / C8 / 6678 / P09486
tenascin precursor (TN); hexabrachion (HXB); cytotactin; neuronectin; GMEM; miotendinous antigen; glioma-associated extracellular matrix antigen / 1.40 / ND / 2.00 / X78565; M55618 / C206 / 3371 / P24821
tenascin-R / 0.79 / ND / 2.33 / X98085 / C213 / 7143 / Q92752
thrombospondin 1 precursor (THBS1; TSP1) / 0.47 / 0.59 / 0.90 / X14787 / C189 / 7057 / P07996
thrombospondin 2 precursor (THBS2; TSP2) / 0.64 / 3.53 / 6.30 / L12350 / C135 / 7058 / P35442
versican core protein precursor; large fibroblast proteoglycan; chondroitin sulfate proteoglycan core protein 2; glial hyaluronate-binding protein (GHAP) / 1.12 / 2.36 / 3.15 / U16306; X15998; U26555; D32039 / C337 / 1462 / P13611
vitronectin precursor (VTN); serum spreading factor; S-protein / 0.64 / 1.41 / 1.31 / X03168 / 563 / 7448 / P04004 P01141
Protein/gene / Stage 0 / Stage 1-2 / Stage 3-4 / Genbank / GENE ID / Locus Link / Swiss
Prot
heparan sulfate proteoglycan (HSPG2) / 2.85 / 1.18 / 1.50 / M85289 / C46 / 3339 / P98160
cartilage-specific proteoglycan core protein (CSPCP); aggrecan core protein precursor (AGC1); chondroitin sulfate proteoglycan core protein 1 (CSPG1) / 0.83 / 0.82 / 1.35 / M55172 / C155 / 176 / P16112 Q13650
bone/cartilage proteoglycan 1 precursor; biglycan (BGN); PGS1 / 1.25 / 0.79 / 2.11 / J04599 / C131 / 633 / P21810
tumor suppressor LUCA1; hyaluronoglucosaminidase (HYAL1) / 0.55 / 1.50 / 0.70 / U03056 / 517 / 3373 / Q12794
hepatocyte growth factor-like protein (HGF activator-like protein); hyaluronan-binding protein (PHBP) / 1.76 / 2.38 / 1.85 / D49742; S83182 / C124 / 3026 / Q14520
hyaluronan receptor (RHAMM) / 0.76 / 1.18 / 0.90 / U29343 / C238 / 3161 / O75330
bone proteoglycan II precursor (PGS2); decorin (DCN) / 1.18 / 1.29 / 2.14 / M14219 / C148 / 1634 / P07585
(d). Plasminogen Activator System
protein C inhibitor (PROCI; PCI); plasma serine protease inhibitor precursor; plasminogen activator inhibitor 3 (PLANH3; PAI3) / 1.42 / 1.37 / 1.43 / M68516; J02639 / 822 / 5104 / P05154
endothelial plasminogen activator inhibitor-1 precursor (PAI1; PLANH1) / 0.79 / 0.04 / 0.05 / X04429; M14083 / C182 / 5054 / P05121
placental plasminogen activator inhibitor 2 (PAI-2; PLANH2); monocyte ARG-serpin; urokinase inhibitor / ND / 1.18 / 0.90 / M18082; J02685 / 396 / 5055 / P05120
plasminogen precursor (PLG) / 0.57 / 2.30 / 1.73 / X05199 / C282 / 5340 / P00747
tissue-type plasminogen activator precursor (T-plasminogen activator; TPA / 0.87 / 1.31 / 2.04 / M15518; X07393; M18182 / 390 / 5327 / P00750
urokinase-type plasminogen activator receptor GPI-anchored form precursor (U-PAR); monocyte activation antigen MO3; CD87 antigen / 1.42 / ND / 1.80 / U08839; M83246; X51675 / 138 / 5329 / Q03405
urokinase-type plasminogen activator precursor (U-plasminogen activator; UPA) / 1.08 / 0.79 / 3.60 / M15476; D00244 / 389 / 5328 / P00749
glia-derived neurite-promoting factor (GDNPF) / 5.14 / 1.90 / ND / A03911 / C119 / 5270 / P03309
alpha-2-macroglobulin precursor (alpha-2-M) / 0.46 / 1.55 / 2.03 / M11313 / C21 / 2 / P01023
alpha-2-macroglobulin receptor-associated protein precursor (alpha-2-MRAP; A2MRAP); low density lipoprotein receptor-related protein- associated protein 1 / 1.76 / 0.59 / 1.35 / M63959 / C39 / 4043 / P30533
Protein/gene / Stage 0 / Stage 1-2 / Stage 3-4 / Genbank / GENE ID / Locus Link / Swiss
Prot
low-density lipoprotein receptor-related protein 1 precursor (LRP); alpha-2-macroglobulin receptor (A2MR); apolipoprotein E receptor (APOER); CD91 antigen / 0.70 / 1.49 / 0.96 / X13916 / C187 / 4035 / Q07954
low-density lipoprotein receptor-related protein 2 precursor (LRP2); megalin / 0.95 / 0.79 / 0.90 / U04441 / C55 / 4036 / P98164
Genes Associated with Cell Death Due to the Toxic Effects of Bile
apoptosis-related protein TFAR15 / 0.50 / 0.40 / ND / AF022385 / C349 / 11235 / O14811
CD27 ligand (CD27LG); CD70 antigen / 0.86 / 1.63 / 1.44 / L08096; S69339 / 180 / 970 / P32970
CD27L antigen receptor precursor; T-cell activation CD27 antigen / 0.77 / 0.27 / 2.17 / M63928 / 235 / 939 / P26842
CD27BP (Siva) / 1.19 / 1.84 / 0.96 / U82938 / C359 / 10572 / O15304
CD30 ligand (CD30L); CD153 antigen / 3.43 / 1.84 / 1.80 / L09753 / 182 / 944 / P32971
lymphocyte activation CD30 antigen; KI-1 / 1.35 / 1.18 / 2.70 / M83554 / 246 / 943 / P28908
CD40 ligand (CD40-L); tumor necrosis factor (TNF)-related activation protein (TRAP); T-cell antigen GP39 / 0.86 / 2.06 / ND / L07414 / 179 / 959 / P29965
CDW40 antigen; CD40L receptor precursor; nerve growth factor receptor-related B-lymphocyte activation molecule / 0.46 / 1.18 / 0.90 / X60592 / 294 / 958 / P25942
cytotoxic ligand TRAIL receptor / 1.16 / 1.85 / 0.96 / U90875 / C256 / 8797 / O00220
death receptor 5 (DR5); cytotoxic TRAIL receptor 2 (TRICK2A) / 1.42 / 1.71 / 0.96 / AF016268 / C376 / 8795 / O15517
TNF-related apoptosis inducing ligand (TRAIL); APO-2 ligand (APO2L) / 3.43 / 2.75 / 2.88 / U57059 / 797 / 8743 / P50591
fas antigen ligand (FASL); apoptosis antigen ligand (APTL; APT1LG1); TNFSF6 / 1.71 / 1.55 / 0.90 / D38122; U08137 / 694 / 356 / P48023
FAS soluble protein; Apo1 / 6.86 / 2.78 / ND / Z70519 / 300 / 355 / Q14292
fasL receptor; apoptosis-mediating surface antigen fas; APO-1 antigen; CD95 antigen / 3.43 / 1.96 / ND / M67454 / 239 / 355 / P25445
lymphotoxin-alpha precursor (LT-alpha); tumor necrosis factor-beta (TNF-beta; TNFB) / 1.47 / 2.47 / 0.96 / D12614 / 24 / 4049 / P01374
lymphotoxin-beta (LT-beta; LTB); tumor necrosis factor C (TNFC) / 1.80 / 3.51 / 1.00 / L11015 / 778 / 4050 / Q06643
OX40 ligand (OX40L); GP34; tax-transcriptionally activated glycoprotein 1 (TXGP1) / 1.14 / 2.33 / ND / X79929 / 298 / 7292 / P23510
secreted apoptosis related protein 1 (SARP1) / 0.89 / 1.74 / 0.96 / AF017986 / C377 / 6423 / O14778
secreted apoptosis related protein 3 (SARP3) / 0.86 / 1.74 / ND / AF017988 / C378 / 6425 / O14780
Protein/gene / Stage 0 / Stage 1-2 / Stage 3-4 / Genbank / GENE ID / Locus Link / Swiss
Prot
tumor necrosis factor receptor (TNFR) + tumor necrosis factor receptor 2 (TNFR2); tumor necrosis factor binding protein 2 (TBP2) / 1.26 / 1.10 / 0.96 / M32315 + M55994 / 13 / 7133 / P20333
tumor necrosis factor-inducible protein TSG-6; hyaluronate-binding protein / 1.37 / 1.36 / 0.96 / M31165 / 209 / 7130 / P98066
WSL protein + TRAMP + Apo-3 + death domain receptor 3 (DDR3) / 2.42 / 2.39 / 0.96 / Y09392 + U75380 + U74611 + U83597 / 803 / 8718 / Q93038
Genes Associated with Rho Family Proteins
Putative rho/rac guanine nucleotide exchange factor (rho/rac GEF); faciogenital dysplasia protein (FGD1) / 0.61 / 0.71 / 1.13 / U11690 / C56 / 2245 / P98174
ras-like protein TC10 / 0.95 / 1.03 / 0.90 / M31470 / C29 / 23433 / P17081
