SUPPLEMENTAL MATERIAL
Enhanced Biotransformation of Triclocarban by Ochrobactrum sp. TCC-1 under Anoxic Nitrate Respiration Conditions
Hui Yun1,2, Bin Liang1,*, Deyong Kong3, Zhiling Li4, Guoshu Qi3, Aijie Wang1,2,4,*
1Key Laboratory of Environmental Biotechnology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, 100085, China
2University of Chinese Academy of Sciences, Beijing, China
3Shenyang Academy of Environmental Sciences, Shenyang, 110167, China
4State Key Laboratory of Urban Water Resource and Environment, Harbin Institute of Technology, Harbin, 150090, China
*Corresponding author: Key Laboratory of Environmental Biotechnology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, Beijing, 100085, China. Tel/fax: +86 10 62915515. E-mail: (Bin Liang); (Aijie Wang).
Fig. S1 Transmission electron micrograph of the strain TCC-1. Bar, 1.0 μm
Fig. S2 Aerobic biotransformation of TCC by strain TCC-1in mineral medium (MM)
Fig. S3 qPCR results for the quantification of 16S rRNA gene in comparison with the copy number of initial condition after the 3rd cycle for each treatment group. The error bars represent the standard deviation. Group I to III under anaerobic conditions and group IV to VI under micro-aerobic conditions.
.
Table S1. The operation procedure of TCC hydrolysis by addition of strain TCC-1 in wastewater sewage sludge for the initial condition and following cycles.
groupphase / I / II / III / IV / V / VI
Anaerobic / Micro-aerobic
initial / NO3--N / + / - / + / + / - / +
biomass / - / + / + / - / + / +
TCC / + / + / + / + / + / +
cycle / NO3--N / + / - / + / + / - / +
TCC / + / + / + / + / + / +
biomass / - / - / - / - / - / -
Note: + represents supply; - represents without supply.
Table S2. Primers used for quantification of 16S rRNA gene (16SreR&F) of the whole bacteria and tccA gene (TccA-reF&R) of strain TCC-1 in wastewater sewage sludge.
primers / Sequence (5’ to 3’) / Fragment length (bp)TccA-reF / GCTGTTGCTCGATGCGATGT / 178
TccA-reR / CCAGGAACGTCTGCTTGACC / 178
16SreR / GAGTAACGCGTGGGAACGTA / 163
16SreF / AGCTATGGATCGTCGCCTTG / 163
S4