Type of Research: Original Paper

Type of research: Original paper

Date of preparation: 2016/03/16

Title: Mechanical insights into the effect of fluctuation in soil moisture on nitrous oxide emissionsfrompaddy soil

Authors: Lan Ma1, 2, Yi Cheng1, Jinyang Wang1, Xiaoyuan Yan1

Affiliations:

1State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, China

2Key Laboratory ofMaterials Physics, Centre for Environmental andEnergy Nanomaterials, Anhui Key Laboratory of Nanomaterials andNanotechnology, Institute of Solid State Physics, Chinese Academyof Sciences, Hefei 230031, China

XiaoyuanYan

Address: Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, China

Tel.: +86 025 8688 1530, Fax: +86 025 8688 1000

Submitted to: Paddy and Water Environment

Table S1. Primer pairs and thermal cyclingconditions used in real-time qPCR analysis.

Targetgene / Primer / Primer sequence 5’-3’ / Reference / Cycling conditions
ArchaealamoA gene / Arch-amoAF
Arch-amoAR / STAATGGTCTGGCTTAGACG
GCGGCCATCCATCTGTATGT / (Francis et al. 2005) / 95°C, 3 min, 1cycle
95°C for 30 s, 55 °C for 30 s, 72°C for 45 s, 35 cycles
BacterialamoA gene / amoA-1F
amoA-2R / GGGGTTTCTACTGGTGGT
CCCCTCKGSAAAGCCTTCTTC / (Rotthauwe et al. 1997) / 95°C, 3 min, 1cycle
95°C for 30 s, 55 °C for 30 s, 72°C for 20 s, 35 cycles
narGgene / narG1960 m2f
narG2050 m2r / TA(CT) GT(GC) GGG CAG GA(AG) AAA CTG
CGT AGA AGA AGC TGG TGC TGT T / (Philippot et al. 2002) / 95°C, 3 min, 1cycle
95°C for 10 s, 56.8 °C for 30 s, 72°C for 20 s, 35 cycles
nirKgene / nirKF1aCu
nirKR3Cu / ATC ATG GT(C/G) CTG CCG CG
GCC TCG ATC AG(A/G) TTG TGG TT / (Throbäck et al. 2004) / 95°C, 3 min, 1cycle
95°C for 10 s, 56 °C for 30 s, 72°C for 20 s, 35 cycles
nirSgene / nirSCd3aF
nirSR3cd / GT(C/G) AAC GT(C/G) AAG GA(A/G) AC(C/G) GG
GA(C/G) TTC GG(A/G) TG(C/G) GTC TTG A / (Throbäck et al. 2004) / 95°C, 3 min, 1cycle
95°C for 10 s, 56 °C for 30 s, 72°C for 20 s, 35 cycles
nosZgene / nosLb
nosRb´ / CCC GCT GCA CAC C(A/G)C CTT CGA
CGT CGC C(C/G)G AGA TGT CGA TCA / (Cheneby et al. 1998) / 95°C, 3 min, 1cycle
95°C for 10 s, 56.8 °C for 30 s, 72°C for 20 s, 35cycles

References

Cheneby D, Hartmann A, Henault C, Topp E, Germon J (1998) Diversity of denitrifying microflora and ability to reduce N2O in two soils. BiolFertil Soils 28: 19-26

Francis CA, Roberts KJ, Beman JM, Santoro AE, Oakley BB (2005) Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. ProcNatlAcadSci USA 102: 14683-14688

Philippot L, Piutti S, Martin-Laurent F, Hallet S, Germon JC (2002) Molecular analysis of the nitrate-reducing community from unplanted and maize-planted soils. ApplEnviron Microbiol 68: 6121-6128

Rotthauwe J-H, Witzel K-P, Liesack W (1997) The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations. Appl Environ Microbiol 63: 4704-4712

Throbäck IN, Enwall K, Jarvis Å, Hallin S (2004) Reassessing PCR primers targeting nirS, nirK and nosZ genes for community surveys of denitrifying bacteria with DGGE. FEMS MicrobiolEcol 49: 401-417

Figure captions

Fig. S1.Relationship between cumulative N2O emission and the relative abundance of nitrifier and denitrifier communities in soils incubated at 40, 65, 80, 100 or 120% WHC to the pre-incubated soil at 30%WHC.Data are means with standard deviations (n = 4). (a: AOA amoA; b: AOB amoA; c: narG; d: nirK; e: nirS; f: nosZ).

Figure. S1.