Serine Phosphorylation and Proline Isomerization in RNAP II CTD Control Recruitment of Nrd1

Supplemental Material for

Serine Phosphorylation and Proline Isomerization in RNAP II CTD Control Recruitment of Nrd1

Karel Kubicek, Hana Cerna, Peter Holub, Josef Pasulka, Dominika Hrossova, Frank Loehr, Ctirad Hofr, Stepanka Vanacova* and Richard Stefl*

correspondence to: (S.V.); (R.S.)

This file includes:

Figures. S1 to S7

Tables S1 to S4

References

Figure S1.

NMR data showing the binding of pSer5 CTD to Nrd1. (A) NMR titration experiments of Nrd1 CID with pSer5 CTD. Overlays of 1H-15N HSQC spectra show the effect of addition of the unlabeled pSer5 CTD to 15N-labeled Nrd1 CID at 20 °C. 1H-15N HSQC spectra of Nrd1 CID alone (in red) and at the peptide to protein ratios of 1/6 (in cyan), 2/6 (in magenta), 3/6 (in orange), 4/6 (in green), 5/6 (in yellow), 6/6 (in blue) are shown. (B) Intermolecular distance constraints were obtained from the three-dimensional F1-13C/15N-filtered NOESY-[13C,1H]-HSQC experiment (Peterson et al., 2004; Zwahlen et al., 1997) acquired on a [13C,15N]-labeled Nrd1/unlabeled pSer5 CTD sample in H2O. An excerpt from a 2D 1H-1H projection of the NOESY spectrum is shown. The red peaks represent the intermolecular NOEs.

Figure S2.

Comparison of different CTD-interacting domains (CIDs) in complex with CTD peptides, highlighting a similar binding mode of CTD peptides. CTD peptides form a β-turn conformation at their SPTS motifs (regardless of the phosphorylation status) and docks into a hydrophobic pocket of CIDs. (A) Nrd1 CID structure (white cartoon) bound to pSer5 CTD (yellow sticks). (B) Rtt103 CID structure bound to pSer2 CTD (PDB ID: 2l0i). (C) Pcf11 CID structure bound to pSer2 CTD (PDB ID: 1sza). (D) SCAF8 CID structure bound to pSer2 CTD (PDB ID: 3D9L).

Figure S3.

(A) Alignment of amino acid sequences of the Nrd1 CID domains from several yeast species aligned using ClustalW (Chenna et al., 2003). a-helices are indicated as red boxes above the alignment. Conserved residues are highlighted with the degree of conservation decreasing from dark green to yellow. (B) Alignment of amino acid sequences of CID domains from different proteins and organisms. Conserved residues are highlighted as in (A) and the black box indicates position of a glycine that is unique to Nrd1.

Figure S4.

Comparison of the cis conformer specific CTD binding to Nrd1 CID and Ssu72. (A) Nrd1 CID structure (white cartoon) bound to pSer5 CTD (yellow sticks). (B) D.m. Ssu72 (green cartoon) bound to pSer5 CTD (blue sticks). (C) Overlay of the CTD peptides from the Nrd1 and Ssu72 complexes, highlighting the similarity of the cis conformation at the pSer5-Pro6 peptide bond.

Figure S5.

Equilibrium binding of Nrd1 CID to different CTD peptides monitored by fluorescence anisotropy. Binding isotherms and dissociation constants (Kd) are shown for the CTD phosphorylated at both Ser5 (Ser5a and Ser5b; pSer5 CTD), phosphorylated only at Ser5a (pSer5(1P) CTD), mutant P6aA (P6aA CTD), mutant P6aR (P6aR CTD), mutant P6bA (P6bA CTD), and mutant P6bR (P6bR CTD).

Figure S6.

Equilibrium binding of Nrd1 CID to pSer5 CTD peptide monitored by fluorescence anisotropy. Binding isotherms and dissociation constants (Kd) are shown for non-essential mutants in the binding pocket or in its close proximity.

Figure S7.

Normalized levels of NEL025C CUT, snR33 snoRNA precursor, and NTS1 CUT were calculated relative to U14 snoRNA expression in each strain. The graphs represent RNA accumulations in mutant strains relative to the control WT strain (BY4741) which was set equal to one.
Table S1.

NMR and refinement statistics for the Nrd1-pSer5 CTD complex.

Nrd1– pSer5 CTD complex
NMR distance & dihedral constraints
Distance restraints
Total NOEs / 1125
Intra-residue / 333
Inter-residue / 792
Short / 316
Medium / 262
Long / 214
Hydrogen bonds
Intermolecular distance restraints / 48
Total dihedral angle restraintsa / 222
Structure statisticsb
Violations (mean and s.d.)
Number of distance restraint violations > 0.5 Å / 0
Number of dihedral angle restraint violations > 15º / 0
Max. dihedral angle restraint violation (º) / 3.22 ± 1.46
Max. distance constraint violation (Å) / 0.35 ± 0.09
Deviations from idealized geometryb
Bond lengths (Å) / 0.0038 ± 0.0001
Bond angles (º) / 1.5129 ± 0.0123
Average pairwise r.m.s.d (Å)b
Nrd1 (8-81;95-150)c
Heavy atoms / 1.77 ± 0.22
Backbone atoms / 1.09 ± 0.27
CTD (4-14)
Heavy atoms / 1.26 ± 0.22
Backbone atoms / 0.85 ± 0.20
Complexc
All complex heavy atoms / 1.75 ± 0.22
All complex backbone atoms / 1.09 ± 0.15
Ramachandran plot statisticsd
Residues in most favored regions (%) / 86.1
Residues in additionally allowed regions (%) / 12.3
Residues in generously allowed regions (%) / 1.1
Residues in disallowed regions (%) / 0.5

a α-helical dihedral angle restraints imposed for the backbone based on the Chemical Shift Index.

b Calculated for an ensemble of the 20 lowest energy structures.

c Excluding flexible loop between a-helix 4 and a-helix 5 of Nrd1.

d Based on PROCHECK analysis (Laskowski et al. 1996)

Table S2.

List of oligonucleotides used in this study.

Name / Sequence 5' to 3'
SVO F71 / ttGCGGCCGCCCTCGTTAGCATGACTCCCC
SVO F72 / ttGAATTCCTGCATTATGGGATGTTTAG
SVO F73 / ttGAATTCGCTATGGACATATCGAATAA
SVO F74 / atCTCGAGGTACTGGATAAGCGCTTATG
SVO F84 / GATTTGAAATCTGGTATTGACGGTTCTGACATTAAGAAAC
SVO F85 / GTTTCTTAATGTCAGAACCGTCAATACCAGATTTCAAATC
CID_S25D_fwd / GATTTGAAATCTGGTATTGACGGTTCTCGTATTAAGAAAC
CID_S25D_rev / GTTTCTTAATACGAGAACCGTCAATACCAGATTTCAAATC
CID_R28D_fwd / CTGGTATTTCAGGTTCTGACATTAAGAAACTAACCAC
CID_R28D_rev / CTGGTTAGTTTCTTAATGTCAGAACCTGAAATACCAG
CID_K30D_fwd / CAGGTTCTCGTATTGACAAACTAACCACTTACG
CID_K30D_rev / CGTAAGTGGTTAGTTTGTCAATACGAGAACCTG
CID_D70R_fwd / CTTTATATATCATCCGTTCAATAGGTAGAGC
CID_D70R_rev / GCTCTACCTATTGAACGGATGATATATAAAG
CID_R74D_fwd / CATCGATTCAATAGGTGACGCTTACTTGGATGAAAC
CID_R74D_rev / GTTTCATCCAAGTAAGCGTCACCTATTGAATCGATG
CID_I29A_fwd / GGTATTTCAGGTTCTCGTGCTAAGAAACTAACCACTTACG
CID_I29A_rev / CGTAAGTGGTTAGTTTCTTAGCACGAGAACCTGAAATACC

Table S3.

List of yeast DNA constructs used in this study.

Designation / vector / NRD1 Allele
V328 / pRS415 / WT
V332 / pRS415 / S25D
V333 / pRS415 / R28D
V334 / pRS415 / K30D
V335 / pRS415 / D70R
V336 / pRS415 / R74D
V342 / pRS316 / WT
V395 / pRS415 / I29A
V396 / pRS415 / R125D
V397 / pRS415 / M126A
V398 / pRS415 / L127A
V399 / pRS415 / L127R
V424 / pRS415 / Δ1-150
V489 / pRS415 / S25D+R28D

Table S4.

List of yeast strains used in this study.

Name / Genotype / Reference
EJS101-9d/
SV74 / MATa; ura3-52; leu2-3,112; trp1-1; his3-11,15; nrd1∆::HIS3; lys2∆2; ade2-1; met2∆1, can1-100; [pRS316NRD1 (NRD1, URA3, CEN)] / (Steinmetz and Brow, 1998)
SV392 / SV74+V328 / This study
SV393 / SV74+empty pRS415 / This study
SV394 / SV74+V332 / This study
SV395 / SV74+V333 / This study
SV396 / SV74+V395 / This study
SV397 / SV74 + V334 / This study
SV398 / SV74 + V335 / This study
SV399 / SV74 + 336 / This study
SV405 / SV74 + V489 / This study
DLY883/
SV326 / ura3-1; ade2-1; his3-11,5; trp1-1; leu2-3,112; can1-100; HISPgal::NRD1 / (Thiebaut et al., 2006)
SV316 / SV326 + empty pRS415 / This study
SV317 / SV326 + V328 / This study
SV318 / SV326 + V332 / This study
SV319 / SV326 + V333 / This study
SV320 / SV326 + V334 / This study
SV339 / SV326 + V395 / This study
SV321 / SV326 + V335 / This study
SV322 / SV326 + V336 / This study
SV414 / SV326 + V424 / This study

References:

Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. (2003). Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res 31: 3497-3500.

Laskowski RA, Rullmannn JA, MacArthur MW, Kaptein R, Thornton JM. 1996. AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR. J Biomol NMR 8: 477-486.

Peterson RD, Theimer CA, Wu H, Feigon J. (2004). New applications of 2D filtered/edited NOESY for assignment and structure elucidation of RNA and RNA-protein complexes. J Biomol NMR 28: 59-67.

Steinmetz EJ, Brow DA. (1998). Control of pre-mRNA accumulation by the essential yeast protein Nrd1 requires high-affinity transcript binding and a domain implicated in RNA polymerase II association. Proc Natl Acad Sci U S A 95: 6699-6704.

Thiebaut M, Kisseleva-Romanova E, Rougemaille M, Boulay J, Libri D. (2006). Transcription termination and nuclear degradation of cryptic unstable transcripts: a role for the nrd1-nab3 pathway in genome surveillance. Mol Cell 23: 853-864.

Zwahlen C, Legault P, Vincent SJF, Greenblatt J, Konrat R, Kay LE. (1997). Methods for measurement of intermolecular NOEs by multinuclear NMR spectroscopy: Application to a bacteriophage lambda N-peptide/boxB RNA complex. J Am Chem Soc 119: 6711-6721.

13