SUPPLEMENTARY INFORMATION
Targeting Myc in KSHV-associated primary effusion lymphoma with BET bromodomain inhibitors
Bhairavi Tolani, Ramakrishnan Gopalakrishnan, Vasu Punj, Hittu Matta and Preet M. Chaudhary‡
From Jane Anne Nohl Division of Hematology and Center for the Study of Blood Diseases, University of Southern California Keck School of Medicine, Los Angeles, California, United States of America
SUPPLEMENTARY METHODS
Western blot
Western blot analysis was performed essentially as described previously (1). Primary antibodies used in these experiments were: c-Myc (Epitomics), GAPDH (Ambion), RTA (a gift from Dr. Gary Hayward, The Sidney Kimmel Comprehensive Cancer Center), BRD4 (a gift from Dr. Peter Howley, Harvard Medical School), Tubulin (mouse monoclonal, Sigma), PARP, Caspace-3 (Cell Signaling), Mcl-1, Bcl-2 Bcl-xL, p27 (Santa Cruz Biotechnology) and mouse monoclonal M2 Flag (Sigma).
c-Myc DNA-binding assay
The DNA-binding activity of the c-Myc was measured in triplicate in the nuclear extractsusing an enzyme-linked immunosorbent assay (ELISA)-based c-Myc DNA binding assay kit (Active-Motif) and following the recommendations of the manufacturer.
Cell viability and cell cycle assays
Logarithmically growing cells were treated with increasing doses of (-)-JQ1, (+)-JQ1, I-BET151 or DMSO for 5 days and subsequently assessed for cell viability using the MTS reagent (3-4,5-dimethylthiazol-2yl)-5-(3-carboxy-methoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) following the manufacturer's instructions (Promega). Percent cell survival was calculated based on the reading of untreated cells as 100%. DNA content analysis was performed as described previously (2). Cell cycle distribution was analyzed on a BD Biosciences LSR II flow cytometry instrument. The flow cytometry data was analyzed by ModFit software.
Apoptosis detection by Annexin V and propidium iodide (PI) staining
PEL cells were treated with 500 nM (+)-JQ1 for 48 hours or left untreated. Following two washes with ice-cold PBS, cells were stained using a FITC Annexin V/PI Apoptosis Detection kit (BD Pharmingen) following the manufacturer’s recommendations. Samples were analyzed by flow cytometry and the resulting data analyzed by FlowJo software.
Senescence β-galactosidase staining
PEL cells were treated with 500 nM (+)-JQ1 for 72 hours, washed with PBS and immobilized on a coverslip coated with Poly-L-Lysine (Sigma). A fixative solution was used to permeabilize cells followed by the use of a Senescence β-galactosidase staining kit as per manufacturer’s recommendations (Cell Signaling). Images were then captured at 200X (total magnification) for the development of blue color.
RNA-Seq and Gene Set Enrichment Analysis (GseaPreranked)
BC1, BCBL1 and JSC1 cells were treated with 500 nM (+)-JQ1 for 8h and then harvested to extract total RNA using the RNeasy Mini Kit (Qiagen) and processed for RNA sequencing on the HiSeq 2000 (Illumina) for 50 cycles. For these experiments six libraries were pooled into a single lane, yielding approximately 30 million reads per sample. The reads were aligned to the human genome (hg19) using TopHat 2.0.5 (3) allowing two mismatches in the alignments. Fold change was calculated from the normalized read counts. We selected 1443 genes which showed ≥1.5 fold change in at least two of the three cell lines with an FDR adjusted p<0.05. A hierarchical clustering was done using Euclidean distance and average linkage using R bioconductor statistical package. Nonparametric gene set enrichment analysis (GSEA) was performed using GSEA 2.07 (Broad Institute, Cambridge, MA) using a pre-ranked list of 350 genes perturbed by ≥ 2 fold by (+)-JQ1 treatment in the three cell lines. We focused on CGP (chemical and genetic perturbations) gene set of Molecular Signatures Database (MSigDB) in running GseaPreranked.
Real-time PCR
PEL cells treated with (+)-JQ1 (500 nM for 8 hours) were harvested to extract total RNA using the RNeasy Mini Kit (Qiagen) and cDNA was synthesized using reverse transcriptase enzyme Superscript II (Invitrogen). Real-time quantitative reverse transcript-polymerase chain reaction (qRT-PCR) was performed with SYBR Green, using gene-specific PCR primers listed in Supplementary Table 1. Samples were run in triplicate, and PCR was performed by an ABI Step One Plus thermocycler (Applied Biosystems). GAPDH was used as housekeeping gene and qRT-PCR data (Ct values) was analyzed using the 2-∆∆ C method as described earlier (4). The qRT-PCR data was presented as fold change in target gene expression ± standard error of mean.
SUPPLEMENTARY FIGURES AND LEGENDS
Supplementary Figure S1. Dose-dependent increase in PEL cell apoptosis upon (+)-JQ1 treatment. (a) PEL (BC1 and BCBL1) and non-PEL (Namalwa) cells were treated with (-)-JQ1 (1000 nM) and (+)-JQ1 (250, 500 and 1000 nM) for 48 hours followed by Annexin-V-FITC/PI staining and analyzed for apoptosis by flow cytometry. Results are representative of two independent experiments and the percentage of Annexin V+/PI+ cells are shown. (b) PEL and non-PEL cells as described in (a) were lysed and analyzed by Western blot for the expression of PARP, Mcl-1, Bcl-xL, and Myc. GAPDH was used as a loading control.
Supplementary Figure S2. (-)-JQ1 did not induce cell cycle arrest or cellular senescence in PEL cells. (a)PEL and non-PEL (Namalwa/Jurkat) cells were exposed to 500 nM (-)-JQ1 for 48 hours, stained with Annexin-V-FITC/PI and analyzed for apoptosis by flow cytometry. Results are representative of two independent experiments. (b)PEL and non-PEL (Namalwa and Jurkat) cells were treated with negative control, 500 nM (-)-JQ1, for 72 hours and its effect on cellular senescence were detected by β-galactosidase staining.
Supplementary Figure S3. Effect of (+)-JQ1 treatment on MYC downstream target genes. PEL (BC1 and BCBL1) cells were treated with 500 nM (+)-for 48 hours followed by real-time PCR. Reactions were performed in triplicate and the data presented as fold change in target gene expression of PMM2 and SLC19A1 (Mean ± SD) after normalization with GAPDH as a housekeeping gene. The results shown are representative of two independent experiments.
SUPPLEMENTARY TABLES
Supplementary Table 1. Sequence of primers used for qRT-PCR.
Gene / Forward Primer / Reverse PrimerGAPDH / GAAGGTGAAGGTCGGAGTC / GAAGATGGTGATGGGATTTC
MYC / CACCGAGTCGTAGTCGAGGT / TTTCGGGTAGTGGAAAACCA
MYB / CTTTCCACAGGATGCAGGTT / GCACCAGCATCAGAAGATGA
TYRO3 / GCAGACAAGTAAAGCTCGGG / ACTACCTCATTGGCGGGAAC
TERT / ATCAGCCAGTGCAGGAACTT / AGCTGACGTGGAAGATGAGC
PMM2 / GGTTCTGGGGTCTGTGAAGA / GTCTTTCCTGATGGATGGGA
SLC19A1 / ATGGCCCCCAAGAAGTAGAT / GTCAACACGTTCTTTGCCAC
HDAC7A / CTGGTGCTTCAGCATGACC / CTCACTGTCAGCCCCAGAG
INHBE / GAAAAGTGAGCAGGGAGCTG / TAACTCATCCTCCACCCCAG
Supplementary Table 2. Sequence of primers used for shRNA cassette construction.
Target Gene / Forward Primer / Reverse PrimerMYC1552 / CCGGCCCAAGGTAGTTATCCTTAAACTCGAGTTTAAGGATAACTACCTTGGGTTTTTG / AATTCAAAAACCCAAGGTAGTTATCCTTAAACTCGAGTTTAAGGATAACTACCTTGGG
hBRD4 497 / CCGGTGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCATTTTG / AATTCAAAAATGAACCTCCCTGATTACTATACTCGAGTATAGTAATCAGGGAGGTTCA
Supplementary Table 3. % Replicate data for Figures 2a and 2b (cell cycle analyses).
Cell Line / Treatment / 1stExperiment (%) / 2ndExperiment (%)Apoptosis / G1 / S / G2 / Apoptosis / G1 / S / G2
BC1 / Untreated / 3 / 43 / 42 / 15 / 0 / 39 / 42 / 19
500 nM (-)-JQ1 / 0 / 40 / 42 / 18 / 0 / 35 / 42 / 23
500 nM (+)-JQ1 / 30 / 86 / 10 / 4 / 22 / 85 / 2 / 13
500 nM I-BET / 5 / 86 / 6 / 8 / 1 / 78 / 12 / 10
BC3 / Untreated / 2 / 62 / 29 / 9 / 2 / 49 / 37 / 14
500 nM (-)-JQ1 / 0 / 57 / 33 / 10 / 0 / 66 / 22 / 11
500 nM (+)-JQ1 / 24 / 85 / 12 / 3 / 11 / 96 / 4 / 0
500 nM I-BET / 5 / 80 / 15 / 5 / 12 / 79 / 15 / 6
BCBL1 / Untreated / 7 / 43 / 37 / 29 / 0 / 54 / 35 / 11
500 nM (-)-JQ1 / 1 / 37 / 49 / 14 / 1 / 50 / 38 / 12
500 nM (+)-JQ1 / 21 / 89 / 5 / 6 / 97 / 92 / 0 / 8
JSC1 / Untreated / 0 / 68 / 20 / 12 / 0 / 68 / 20 / 12
500 nM (-)-JQ1 / 0 / 61 / 30 / 9 / 2 / 60 / 31 / 9
500 nM (+)-JQ1 / 0 / 84 / 0 / 16 / 0 / 84 / 15 / 1
Namalwa / Untreated / 0 / 42 / 48 / 10 / 0 / 41 / 50 / 10
500 nM (-)-JQ1 / 0 / 27 / 58 / 15 / 1 / 44 / 45 / 11
500 nM (+)-JQ1 / 0 / 45 / 45 / 10 / 0 / 33 / 47 / 20
Jurkat / Untreated / 0 / 50 / 39 / 11 / 3 / 53 / 37 / 10
500 nM (-)-JQ1 / 8 / 43 / 43 / 14 / 0 / 43 / 39 / 18
500 nM (+)-JQ1 / 0 / 50 / 37 / 13 / 14 / 61 / 9 / 30
Supplementary Table 4. % Replicate data for Figures 6b (cell cycle analyses).
BC1 Cell Line / Treatment / 1stExperiment / 2ndExperimentG1 / S / G2 / G1 / S / G2
shControl / Untreated / 43 / 42 / 15 / 58 / 31 / 12
500 ng/mL Dox / 48 / 38 / 14 / 60 / 28 / 12
shBRD4 / Untreated / 54 / 33 / 13 / 63 / 36 / 0
500 ng/mL Dox / 64 / 24 / 12 / 75 / 25 / 0
shMyc / Untreated / 61 / 26 / 13 / 44 / 40 / 16
500 ng/mL Dox / 72 / 24 / 4 / 51 / 33 / 16
SupplementaryTable 5. % Replicate data for Figure 7d (cell cycle analyses).
BC1 Cell Line / Treatment / 1stExperiment / 2ndExperimentG1 / S / G2 / G1 / S / G2
Vector / Untreated / 60 / 30 / 10 / 35 / 43 / 22
250 nM (+)-JQ1 / 89 / 3 / 8 / 89 / 5 / 6
Myc T58A / Untreated / 71 / 22 / 7 / 59 / 30 / 11
250 nM (+)-JQ1 / 67 / 24 / 9 / 73 / 19 / 8
SUPPLEMENTARY REFERENCES
1.Matta H, Sun Q, Moses G, Chaudhary PM. Molecular genetic analysis of human herpes virus 8-encoded viral FLICE inhibitory protein-induced NF-kappaB activation. Journal of Biological Chemistry. 2003;278(52):52406-11.
2.Zhu X, Santat LA, Chang MS, Liu J, Zavzavadjian JR, Wall EA, et al. A versatile approach to multiple gene RNA interference using microRNA-based short hairpin RNAs. BMC Mol Biol. 2007;8:98.
3.Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, et al. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature protocols. 2012 Mar;7(3):562-78.
4.Zhao J, Punj V, Matta H, Mazzacurati L, Schamus S, Yang Y, et al. K13 Blocks KSHV Lytic Replication and Deregulates vIL6 and hIL6 Expression: a Model of Lytic Replication Induced Clonal Selection in Viral Oncogenesis. PLoS ONE. 2007 Oct 24;2(10):e1067.