Transcriptomic analysis reveals cold responsive genes implicated in peach low temperature tolerance
V. Falara1, G.A. Manganaris2,3, F. Ziliotto3, A. Manganaris4, C. Bonghi3*, A. Ramina3, A.K. Kanellis1*
1Group of Biotechnology of Pharmaceutical Plants, Lab of Pharmacognosy, Department of Pharmaceutical Sciences, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece
2CyprusUniversity of Technology, Department of Agricultural Production and Food Science and Technology, Lemessos, 50329, Cyprus
3Department of Environmental Agronomy and Crop Science, University of Padova, Viale dell’Università 16, 35020, Legnaro (Padova), Italy
4Department of Crop Production, Technological Educational Institute, 57400, Sindos-Thessaloniki, Greece
*Corresponding authors
Angelos K. Kanellis
Department of Pharmaceutical Sciences, AristotleUniversity of Thessaloniki, 54124 Thessaloniki, Greece
Tel: +302310997656
FAX: +302310997662
E-mail:
Claudio Bonghi
Department of Environmental Agronomy and Crop Science, University of Padova, Viale dell’Università 16, 35020, Legnaro (Padova), Italy
Tel: +390498272844
FAX:+390498272850
E-mail:
Supplementary Tables
Table S1. Gene names, their abbreviations along with the number of contig characterised in the dedicated peach database and the set of primers used to obtain the cDNA fragment used as probe in northern analyses as supplementary table.
Gene name / Abbreviation / Primers / Forward / Size (bp)Reverse
Heat shock protein 17.4 [Quercus suber] / HSP_3065* / - / 705
small heat shock protein - soybean / HSP_3067 / CTGCAATGGAGAATGGGGTTCT / 147
GTGCTTCCACAGAGTTTGTAG
Dehydrin [Prunus persica] / Dhd_1528 / GATGGAATGGATCATCATTTGGAC / 343
CCAAGGCTCCTACCTTTCCTC
Dehydration-induced protein RD22-like protein [Gossypium hirsutum] / RD-22_974 / GCAGGAATATAGGATTGCGAGG / 181
CGGTTGCTGTTTGCCACAGC
Pathogenesis-related protein PR-4B precursor [Nicotiana tabacum] / PR-4B_1026 / CTACGACTTTGTTGACTGTGGC / 177
GCTTCTGGagtaaatgatcatttgcatt
Lipoxygenase (EC 1.13.11.12) loxD - tomato / LOX_4304 / GACCCTCCAAAGTTAATCTCTGG / 194
GGAGGAGCATATAATAGGCCATC
Putative beta-D-xylosidase (PpAz152) / Xyl_1031 / gcccacaatctggcacatggg / 149
cctggacgtacacgtggatgt
Expansin [Prunus persica] / Exp_676** / - / 1340
*HSP_3065 was gift from Dr. Ann Callahan,**Exp_676 was a gift from Dr.Hiroko Hayamα,
*HSP_3065 was gift from Dr. Ann Callahan,**Exp_676 was a gift from Dr.Hiroko Hayamα,
Legend to Table S2
Table S2.List of probes showing significant expression values afterSignificant Analysis for Microarrays (SAM analysis) in each of the four comparisons performed in the trial. A total of 444 probes showed significant expression values after SAM analysis in at least two of the four (4 w + 1d vs. 0 w + 1 d‘Morettini No2’; 6w + 1 d vs. 0 w + 1d‘Morettini No2’; 4 w + 1d vs. 0 w + 1 d‘Royal Glory’4 w + 1d vs. 0 w + 1 d‘Royal Glory’) hybridizations performed in the trial. “Ctg” refers to the peach contig number present in the database and used to synthesize the oligo probes for the µPEACH1.0 microarray.“Oligo ID” is the code assigned to each transcript (444 out of 4,806) by the manufacturer (Operon). “At gene” is the AGI Locus (ATH AGI code TAIR 7) of the Arabidopsis gene best hit for each peach contigs obtained using BLASTX against the TAIR protein 7 database. “Description” is the name assigned to Arabidopsis gene best hit for peach contigs. “Mapman BIN” is the BIN and subBIN (/) assigned to the Arabidopsis gene best hit for peach contigs. The following eight columns report the microarray results: 4 w (0°C) + 1 d (25°C)/1 d (25°C) ‘Morettini No2’ and stdev report [log2 (intensity 4weeks/intensity T0 and relative standard deviation value]; 6weeks (0°C) + 1 day (25°C) /1 day (25°C) ‘Morettini No2’ and stdev report reports [log2 (intensity 6 weeks (0°C) + 1 day (25°C)/intensity 1 day (25°C)) and relative standard deviation value]; 4weeks (0°C) + 1 day (25°C) /1 day (25°C) ‘Royal Glory’ and stdev report [log2 (intensity 4weeks (0°C) + 1 day (25°C)/intensity 1 day (25°C)) and relative standard deviation value]; 6weeks/1 day (25°C) ‘Royal Glory’ and stdev reports [log2 (intensity 6 weeks(0°C) + 1 day (25°C)/intensity 1 day (25°C)) and relative standard deviation value]. Green is used to highlight down-regulated genes (log2 ratio ≤ −1.0), red to highlight up-regulated genes (log2 ratio ≥ 1.0), and yellow for genes showing no differential expression (log2 ratio > −1 and <1). Ns and NA indicate probes that were not significant at SAM analysis and data not available, respectively.
Legend to Figure 1S
Fig. 1S. Differentially expressed transcripts in peach fruit of cultivars ‘Morettini No2’ and ‘Royal Glory’ after 4 and 6 weeks of cold storage (0°C) plus 1 day shelf life (25°C). Numbers associated to light-grey bars represent up- (above) and dark grey represent down- (bottom) regulated transcripts identified via microarray analysis in the four samples compared to fruit 1 day after harvest. A total of 185 and 355 transcripts have been considered for ‘Morettini No2’ (left) and ‘Royal Glory’ (right) comparisons, respectively, according to SAM (Table S2, supplementary material). Numbers of the up- and down-regulated transcripts in the 4 weeks samples showing the same expression pattern with the 6 weeks samples are indicated within the dotted lines. Numbers associated with the white bars indicate constitutively expressed mRNA after 4 and 6 weeks cold storage plus 1 day shelf life.
In sensitive cultivar ‘Morettini No2’, among the 100 up-regulated transcripts after 4 weeks at 0°C + 1 day at 25°C, only 53 remained still induced after 2 additional weeks in storage. In the same sample an additional set of 12 genes, not differentially expressed after 4 weeks at 0°C + 1 day at 25°C, wereinduced leading to a total number of 65 up-regulated genes. Similar trend was also observed in ‘Royal Glory’, where among the 158 up-regulated messages after 4 weeks cold storage plus 1 day shelf life; only 38 were still induced after 6 weeks cold storage and 1 day shelf life, with an additional set of 18 transcripts not differentially expressed after 4 weeks cold storage + 1 day at room temperature, for a total of 56 genes. Considering the down-regulated genes, among the 155 ones observed after 4 weeks at 0°C + 1 day at 25°C, only 33 were still down-regulated after 6 weeks at 0°C + 1 day at 25°C, in addition to a set of 24 transcripts, whose expression did not change after removal from 4 weeks of cold storage and subsequent maintenance at room temperature for 1 day.