SUPPLEMENTARY METHODS AND TABLES.
Mycobacterial species, culture and storage. M. bovis-BCG was a kind gift of Bill Jacobs’ laboratory (Bronx, NY), M. tuberculosis strain H37Rv was obtained from the American Type Culture Collection (ATCC, Manassas, VA), rifampin-resistant M. tuberculosis strains were obtained from the United Nations Children’s Fund/UNDP/World Bank/WHO Special Programme for Research and Training in Tropical Diseases sample bank (1), other mycobacterial species and strains were either isolated from patients and identified by standard biochemical tests (5) or DNA probes (Gen-Probe AccuProbes) (8), or obtained from the ATCC (Supplementary Table S2). Cultures were grown to log phase at 37°C on a rotary shaker in Middlebrook 7H9 medium (Difco, http://www.vgdusa.com/DIFCO.htm) containing 0.05% Tween80, 0.02% glycerol (Sigma, http://www.sigmaaldrich.com), and 10% ADC (Difco). Cultures were quantified by plating on Middlebrook 7H10 agar (Difco) supplemented with 10% ADC, and aliquots of approximately 2x108 cfu/mL were stored at -80°C for later use. Defrosted mycobacterial aliquots were sonicated in a high-intensity cup horn sonicator (30 seconds at 500 watts, pulse 3 times; Branson Ultrasonics, Danbury, CT) to break up cell clumps. Sonicated cells were diluted 20-fold in TET buffer (50mM Tris, 0.1mM EDTA, 0.1% Tween20, pH 8.4) and vortexed for 1 minute to disrupt any remaining clumps. 200µL of the appropriate concentration of bacilli, diluted in TET buffer, was added to 1.8mL of sputum to prepare the spiked sputum samples.
Details of the Xpert MTB/RIF Assay. The complete Xpert MTB/RIF kit (Cepheid) used in the assay consists of the Xpert MTB/RIF cartridge, a NaOH and isopropanol-containing sample reagent (SR) that is used to liquefy sputum samples and to inactivate M. tuberculosis prior to transfer into the cartridge, and transfer pipettes to transfer the SR-treated sputum from the sputum cup into the cartridge. The Xpert MTB/RIF Assay uses a basic Cepheid A-type cartridge containing a membrane filter for cell capture, as is used in the Group B Streptococcus (GBS) (3) and Bacillus anthracis (9) Cepheid assays. However, the Xpert MTB/RIF cartridge comes prefilled with the wash buffer and lyophilized reagents needed to perform sputum processing and hemi-nested PCR of the M. tuberculosis rpoB core region. The cartridge also includes lyophilized Bacillus globigii spores, which serve as an internal sample processing and PCR control. The ready to use, prefilled cartridges are stable for a minimum of 8.5 months at 25ºC. The manufacture recommends that the cartridges should be autoclaved after use and prior to disposal.
Details of the automated portion of the assay protocol. Within the Xpert MTB/RIF cartridge, the first 200µL of the liquefied sputum was drawn through a prefilter and then dispensed into a chamber containing the internal control B. globigii spores. The sputum/B. globigii spore mixture was then dispensed through the cartridge’s sub-micron filter to a waste chamber, capturing the bacilli and the control spores on the filter. The filtrate was transferred into a waste chamber integrated within the cartridge. Another 1200µL of the remaining liquefied sputum was then similarly drawn in sequence through the prefilter, and dispensed through the sub-micron filter on its way into the integrated waste chamber. The filter (which now contained any mycobacteria that had been present in the sputum sample) was then washed with buffer to remove PCR inhibitors and neutralize the SR. The captured microorganisms were ballistically lysed using the ultrasonic horn that is integrated into the GeneXpert, and the DNA eluted with 90µL of buffer into a collection chamber. Eluted DNA was combined with the lyophilized reagent beads, which contain Taq polymerase, dNTPs, buffers and primers for the first of the two hemi-nested PCR reactions, and then was moved into the integrated real-time PCR reaction tube. The first PCR reaction consisted of an activation step of 95°C for 120s, followed by 16 cycles of melt at 95°C for 5s and anneal-extension at 72°C for 40s. The resulting PCR products were moved from the PCR tube to a cartridge waste chamber (which contains a frit to absorb the liquid and prevent amplicon spread), and reconstituted beads containing amplification and detection reagents for the second of the hemi-nested PCR reactions were moved into the integrated PCR tube (the DNA target for the second PCR reaction was contained within the small volume retained in the PCR tube after the first PCR reaction was moved to waste). After quality checks were executed to ensure successful reagent hydration, amplification in the second PCR reaction (an activation step of 95°C for 120s, followed by 45 cycles of melt at 95°C for 5s; anneal at 64°C for 20s and extension at 72°C for 30s) was recorded and analyzed in real time by the GeneXpert software, which reviews signals from the B. globigii internal control and the five M. tuberculosis rpoB probes for acceptability and calculates cycle thresholds (Ct) for each probe.
Analysis of rifampin-susceptible and rifampin-resistant DNA. A comprehensive literature search identified all 19 RRDR mutations that account for at least 0.5% of rifampin-resistant M. tuberculosis strains (unpublished review of over 4000 rifampin-resistant strains). Genomic M. tuberculosis DNA samples containing 12 of these rpoB mutations as well as DNA from four rifampin-susceptible clinical strains with wild type RRDR sequences were obtained from the WHO/TDR (Geneva, Switzerland) (1) and the Kreisworth (6) strain banks. Full-length (210 bp) double-stranded artificial targets were created for the remaining seven common rpoB mutations and for four additional mutations. These targets were created by sequential overlap extension PCR reactions (4), using 50-100bp oligonucleotides (Invitrogen, Carlsbad, CA) containing the mutation of interest. DNA could not be tested on the GeneXpert system using the standard protocol because the filtering step would fail to capture the DNA. As a close approximation of the full protocol, 10µL of genomic DNA or artificial target, diluted to 104copies/µL, was added into a cartridge chamber containing wash buffer. SR-treated MTB-negative sputum was also loaded into each cartridge. Samples were processed on the GeneXpert with GeneXpert Software Version 6, which allowed for real-time PCR of the input DNA.
Analytic tests of SR killing activity. 100mL cultures of log-phase M. tuberculosis H37Rv, grown to an optical density of 0.7 to 0.9, were concentrated by centrifugation. Bacterial cell clumps were disrupted by sonication as described above. 50µL of concentrated H37Rv was added to 0.5mL sputum aliquots, and treated with 1 or 2mL SR according to the Xpert MTB/RIF protocol. Samples were digested at room temperature for 15 minutes to 5 days, in triplicate. An equal number of cells were left untreated as a positive control. 45mL of 6.8mM Phosphate Buffered Saline (Sigma) was added at the end of the designated incubation period to inactivate the SR. Samples were concentrated by centrifugation, and pellets were resuspended in 0.5mL PBS. Log reductions in viability were determined by cfu plating, comparing treated samples to the positive control. To determine the effects of the length of incubation on detection of low concentrations of M. tuberculosis, sputum containing 150 cfu/mL BCG was incubated with SR for 15 minutes to 5 days before being processed in the GeneXpert.
9
Supplementary Table S1. Primer and molecular beacon sequences used in the assay.
Primer/Probe / Sequence1 / Ref.rpoB F1 Primer / 5'- cgtggaggcgatcacaccgcagac -3'
rpoB F2 Primer / 5’- atcaacatccggccggtggtcgcc -3'
rpoB R Primer / 5’- agC2tccagcccggcacgctcacgt -3'
rpoB Probe A / 5'-CF36-CGAGCtcagctggctggtgcGCTCG-Q48-3' / (7)
rpoB Probe B / 5'-CF4-TGTGgagccaattcatggaccagaGCACA-Q13-3'
rpoB Probe C / 5'-CF5-CCGACGccgacagcgggttgttCGTCGG-Q8-3' / (2)
rpoB Probe D / 5'-CF3-CCACGcttgtgggtcaaccccCGTGG-Q13-3' / (7)
rpoB Probe E / 5'-Fluoresceine-ACGAGccgactgtcggcgcuggCTCGT-Q13-3'
B. globigii F Primer / 5’- agcgcttgcggcaaacacggagaaa -3'
B. globigii R1 Primer / 5’- gcgacaccggcgaatacagagatacc -3'
B. globigii R2 Primer / 5’- gctccaccgaacaatccgatcttaccgccc -3’
B. globigii Probe / 5’-CF1-GGCCGacagacaaggctccgtcatttgatCGGCC-Q8-3’
1Upper case indicates molecular beacon arm sequences.
2Bold uppercase to indicate an intentional mismatch with the M. tuberculosis sequence).
3CF signifies proprietary Cepheid fluorophores.
4Q signifies proprietary Cepheid quenching molecules.
Supplementary Table S2. Mycobacterial species used in this study.
M. tuberculosis / H37Rv / ATCC1
M. bovis-BCG / BCG / see text
M. africanum / 35711 / ATCC
M. avium / SmT 2500 / Patient sample
M. avium / SmD 2501 / Patient sample
M. intracellulare / 35790 / ATCC
M. intracellulare / 23434 / ATCC
M. kansasii / 35776 / ATCC
M. abscessus / 19977 / ATCC
M. asiaticum / E1-1985 / Patient sample
M. celatum / 51131 / ATCC
M. chelonae / 35749 / ATCC
M. flavescens / PoH193D / Patient sample
M. fortuitum / 35754 / ATCC
M. genevenses / 51233 / ATCC
M. gordonae / 14470 / ATCC
M. malmoense / 29571 / ATCC
M. marinum / CapE10 / Patient sample
M. scrofulaceum / CapE5-1985 / Patient sample
M. simiae / 25275 / ATCC
M. szulgai / Cap59-1997 / Patient sample
M. terrae / 15755 / ATCC
M. thermoresistable / E22-1985 / Patient sample
M. trivial / 23292 / ATCC
M. xenopi / 2278 / ATCC
1American Type Culture Collection
Supplementary REFERENCES
1. Chakravorty, S., B. Aladegbami, A. S. Motiwala, Y. Dai, H. Safi, M. Brimacombe, D. Helb, and D. Alland. 2008. Rifampin resistance, Beijing-W clade-single nucleotide polymorphism cluster group 2 phylogeny, and the Rv2629 191-C allele in Mycobacterium tuberculosis strains. J Clin Microbiol 46:2555-60.
2. El-Hajj, H. H., S. A. Marras, S. Tyagi, F. R. Kramer, and D. Alland. 2001. Detection of rifampin resistance in Mycobacterium tuberculosis in a single tube with molecular beacons. J Clin Microbiol 39:4131-7.
3. Gavino, M., and E. Wang. 2007. A comparison of a new rapid real-time polymerase chain reaction system to traditional culture in determining group B streptococcus colonization. Am J Obstet Gynecol 197:388 e1-4.
4. Higuchi, R., B. Krummel, and R. K. Saiki. 1988. A general method of in vitro preparation and specific mutagenesis of DNA fragments: study of protein and DNA interactions. Nucleic Acids Res 16:7351-67.
5. Kent, P. T., and G. P. Kubica. 1985. Public Health Mycobacteriology: A Guide for the Level III Laboratory. US Department of Health and Human Services, CDC, Atlanta, GA.
6. McCammon, M. T., J. S. Gillette, D. P. Thomas, S. V. Ramaswamy, E. A. Graviss, B. N. Kreiswirth, J. Vijg, and T. N. Quitugua. 2005. Detection of rpoB mutations associated with rifampin resistance in Mycobacterium tuberculosis using denaturing gradient gel electrophoresis. Antimicrob Agents Chemother 49:2200-9.
7. Piatek, A. S., S. Tyagi, A. C. Pol, A. Telenti, L. P. Miller, F. R. Kramer, and D. Alland. 1998. Molecular beacon sequence analysis for detecting drug resistance in Mycobacterium tuberculosis. Nat Biotechnol 16:359-63.
8. Reisner, B. S., A. M. Gatson, and G. L. Woods. 1994. Use of Gen-Probe AccuProbes to identify Mycobacterium avium complex, Mycobacterium tuberculosis complex, Mycobacterium kansasii, and Mycobacterium gordonae directly from BACTEC TB broth cultures. J Clin Microbiol 32:2995-8.
9. Ulrich, M. P., D. R. Christensen, S. R. Coyne, P. D. Craw, E. A. Henchal, S. H. Sakai, D. Swenson, J. Tholath, J. Tsai, A. F. Weir, and D. A. Norwood. 2006. Evaluation of the Cepheid GeneXpert system for detecting Bacillus anthracis. J Appl Microbiol 100:1011-6.
9