Warm-Ups, Ctqs, and Closuresweek 10

Due Monday, November 6th

Unit 3A-B Test Friday, November 10th

Warm-Ups, CTQs, and ClosuresWeek 10

Words for notecards (9 words)

Translation intron vector promoter gel electrophoresis

Codon phenotype transformation restriction enzyme

Monday, 10/30

Warm-Up:A secondary structure is a two-dimensional structure characterized by the association between monomers in a polymer. In proteins, common secondary structures include beta pleaded “sheets” and alpha helices. Describe how RNA is able to form secondary structures.

CTQ #1:Mutations are alterations in DNA sequence which may or may not affect protein sequence. Substitutions are mutations in which a single nucleotide base is replaced with a different nucleotide (for example, adenine replaced with guanine). Deletions are mutations in which a nucleotide is removed. From the two mutation sequences below, predict which mutation will more adversely affect protein sequence. Justify your prediction. (LO 3.6)
Wild-type (natural) gene sequence: 5’ ATGTACGGAACGGCA 3’
Substitution mutation sequence: 5’ ATGTACAGAACGGCA 3’
Deletion mutation sequence: 5’ ATGTACGAACGGCA 3’

BONUS:Based on the structures of DNA and RNA, explain why RNA can and DNA cannot serve as a template for protein synthesis at the ribosome.

Closure:Describe how a codon instructs the ribosome to add a specific amino acid to a growing polypeptide chain. (LO 3.4)

Tuesday, 10/31

Warm-Up:Insulin is a protein hormone released into the bloodstream by the pancreas to regulate blood glucose (sugar) levels. Describe how insulin is secreted by pancreatic cells. Use at least FOUR organelles, including the nucleus, in your description. (LO 4.4)

CTQ #1:A gene encodes a pre-mRNA with the following sequence:
5’ GCAUGGGGGAUAAGAAUCGCGCAAUUU GCGGCGAAAAGCUAGGUCACACGAGUAA 3’
The underlined sequences represent introns, and the non-underlined sequences represent exons. Predict the amino-acid sequence of the translated polypeptide.

CTQ #2:Predict the effects on lactase function if the third codon of lactase gene was mutated to change the mRNA sequence from UAU to UAG. Justify your prediction. (LO 3.6)

Closure:Describe how the unique structure of eukaryotic cells prevents translation from being coupled to transcription.

Wednesday, 11/01

Warm-Up:Plasmids are circular pieces of DNA which bacterial cells are able to take up from the environment, then replicate and transcribe. Eukaryotic cells, by contrast, contain large, linear (non-circular) DNA molecules called chromosomes. Predict which type of DNA (plasmid or chromosome) would require greater activity of topoisomerase during replication, and justify your prediction.

CTQ #1:Scientists are able to purify mRNA from the human insulin gene in vitro (in a test tube using enzymes). They then use the purified RNA to synthesize DNA. Finally, they insert the synthesized DNA into a linearized (cut open) plasmid. State the THREE enzymes they must use during this process.

CTQ #2:Kanamycin is an antibiotic which is used in transformation experiments. Explain why discrete colonies form on kanamycin-treated plates following a transformation experiment using a plasmid encoding kanamycin resistance. (LO 3.5)

Closure:Describe the difference, and the importance, between ampicillin and arabinose in a bacterial transformation experiment.

Thursday, 11/02

Warm-Up:Explain how a codon instructs the ribosome to add a specific amino acid to a growing polypeptide chain.

CTQ #1:The plasmid below was digested in two separate experiments, one with EcoRI only and one with EcoRI AND BamHI. For each experiment, state the sizes of the bands (in base-pairs or bp) that would appear following gel electrophoresis. (LO 3.5)

CTQ #2:Calculate how many DNA molecules would be present if polymerase chain reaction (PCR) was conducted on a single DNA molecule for 25 rounds of amplification.

Closure:Two pieces of DNA, one a circular plasmid and one a linear piece of DNA, each contain exactly one EcoRI site. Justify how many bands you would expect to see from the digestion of each DNA. (LO 3.5)

Friday, 11/03 (Review Day)

Warm-Up:Translate this mRNA sequence: 5' AUGAACAAUAGACCGUAG 3'