Table 1. PCR primers used for the apple microbial diversity analyses

PCR Primer / Primer sequence (5’-3’)
Prokaryotic
Pk16F / AGAGTTTGATCATGGCTCAG
Pk16R / CTTGTTACGACTTCACCCCA
Pk23R / CACGGTACTAGTTCACTATCGGTC
PkITSF / GTCGTAACAAGGTAGCCGTA
PkITSR (6-FAM) / TGACTGCCAAGGCATCCACC
Eukaryotic
Ek18F / AGAGGAAGTAAAAGTCGTAACAAG
EkITS1F / CTTGGTCATTTAGAGGAAGTAA
Ek28R (VIC) / ATATGCTTAAGTTCAGCGGG

Table 2. Database matches obtained from sequenced prokaryotic PCR bands

Sequence name / Best database match / Percent identity / Accompanying database notes
BE12 and BE14 / Pseudomonas graminis / 98.7% / A taxonomic study of bacteria isolated from grasses: a proposed new species Pseudomonas graminis sp. nov
BE1, BE6 and N2B7 / Pseudomonas avellanae / 98%
BE10 and BE11 / Pantoea/Enterobacter agglomerans / 97.6% / Endophytic bacterial communities of field-grown potato plants and their plant-growth-promoting and antagonistic abilities
NB1 / Unknown

22

Table 3. Database matches obtained from eukaryotic PCRs

Sequence name / Best database match / Percent identity / Accompanying database notes
GF2 / Ophiostoma querci / 100% / Fungal diseases of European oaks
GF3 and F8 / Cryptococcus skinneri / 94.5% / Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions
GF5and GF12 / Stemphylium solani
Pleospora herbarum / 98.8%
99.3% / ERIC and REP-PCR Banding Patterns and Sequence Analysis of the Internal Transcribed Spacer of rDNA of Stemphylium solani Isolates from Cotton.
Comparison of nuclear ribosomal DNA sequences from Alternaria species pathogenic to crucifers
GF7 / Ascomycete sp. DAR 73142 / 100% / Three Neofabraea species on pome fruit in Australia
GF9 / Cryptococcus sp. CBS 7743 / 99.3% / Cryptococcus nyarrowii sp. nov., a basidiomycetous yeast from Antarctica
GF10 / Cystofilobasidium macerans
Cystofilobasidium infirmominiatum / 98.6%
94% / Systematics of basidiomycetous yeasts
Mode of action and delay of fungicide resistance associated with the biocontrol yeast Cryptoccocus infirmominiatum
GF11 / Pseudozyma fusiformata
Pseudozyma hubeiensis / 99.2%
93.7% / The first isolation of ustilaginomycetous anamorphic yeasts, Pseudozyma species, from patients' blood and a description of two new species: P. parantarctica and P. thailandica
Pseudozyma hubeiensis sp. nov. and Pseudozyma shanxiensis sp. nov., novel ustilaginomycetous anamorphic yeast species from plant leaves
GF13 / Cryptococcus tephrensis / 97.7% / Cryptococcus foliicola sp. nov. and Cryptococcus taibaiensis sp. nov., novel basidiomycetous yeast species from plant leaves
GF14 / Udeniomyces pannonicus / 98.1% / Udeniomyces pannonicus sp. nov., a ballistoconidium-forming yeast isolated from leaves of plants in Hungary
GF4N / Lewia infectoria
Alternaria triticina / 96.8% / specific_host="Vigna sinensis (leaves)"
specific_host="Triticum aestivum (leaves)"
GF5N / Cryptococcus victoriae / 97.1% / Systematics of basidiomycetous yeasts

22

Table 4. Example of prokaryotic scores from above blue ARISA electropherogram

Species peak / 465 / 485 / 562 / 581 / 589 / 598 / 605 / 620 / 635 / other
Sample 137 / x / x / x / x / x / x / x

Table 5. Example of eukaryotic scores from above green ARISA electropherogram

Species peak / 531 / 543 / 552 / 561 / 564 / 668 / 582 / 608 / 624 / 648 / other
Sample 136 / x / x / x

Table 6. Dates and growth stage at which treatments were applied to orchard plots

Growth stage / Treatment / Application date
2002 / 2003 / 2004
Green cluster / pink bud / urea / 28 March / 9 April / 16 April
Petal fall / urea / 13 May / 15 May / 18 May
Petal fall + 14 days / urea / 28 May / 2 June / 9 June
Petal fall + 28 Days / urea / 17 June / 24 June / 18 June
Fruitlet / Stoppit / 2 July / 7 July / 30 June
Fruitlet / Stoppit / 16 July / 22 July / 20 July
Fruitlet / Stoppit / 26 July / 4 August / 30 July
Fruitlet / Stoppit / 5 August / 26 August / 13 August

Table 7. Sample dates and tree parts sampled for microflora assessments

Growth stage / Tree part sampled / Sample date
2002 / 2003 / 2004
Early flower / Flower truss / 16 April / - / -
Late flower / Flower truss / 30 April / - / -
Late flower / Rosette leaves / - / 12 May / 11 May
Early fruitlet / Fruitlets + rosette leaves / 21 May / 4 June / 17 June
Fruitlet / Rosette leaves / 24 June / 4 June / -
Fruitlet / Rosette leaves / 17 July / 16 July / -
Fruitlet / Rosette leaves / 28 August / 12 August / 18 August
Harvest / Fruit / 11 September / 10 September / 7 October
Harvest / Rosette leaves / 16 September / 8 October

22

Table 8. TL109, %loss due to rots for each plot in 2001 prior to application of treatments. Plots 1-9 are unsprayed, plots 10-18 received a conventional pesticide programme for pests and diseases

Plot / Total % rots / Brown rot / Phytopht / Botrytis / Nectria / Gloeospor / Penicilliu / Phomopsis / Botryosp / Other /

1

/ 11.1 / 3.4 / 1.0 / 0 / 3.6 / 1.4 / 0.3 / 1.3 / 0.1 / 0
2 / 10.3 / 3.1 / 0.4 / 0.4 / 3.7 / 0.8 / 1.0 / 0.7 / 0.1 / 0
3 / 10.2 / 2.8 / 0.3 / 0.04 / 3.5 / 0.9 / 0.3 / 0 / 0.2 / 0
4 / 5.2 / 3.2 / 0.6 / 0 / 0.9 / 0.5 / 0 / 0.1 / 0 / 0
5 / 10.8 / 5.8 / 1.6 / 0.1 / 1.8 / 1.1 / 0.1 / 0.2 / 0 / 0
6 / 11.2 / 3.8 / 0.9 / 0.4 / 2.2 / 0.5 / 0.4 / 2.6 / 0.1 / 0
7 / 7.6 / 1.5 / 1.2 / 0.4 / 2.7 / 0.2 / 0.1 / 1.2 / 0.1 / 0
8 / 3.0 / 1.4 / 0.4 / 0.03 / 0.6 / 0.2 / 0.04 / 0.4 / 0 / 0
9 / 7.3 / 2.1 / 0.9 / 0.6 / 1.6 / 0.1 / 0.1 / 1.8 / 0.1 / 0
0
10 / 3.1 / 1.2 / 0.5 / 0.2 / 0.4 / 0.6 / 0.04 / 0.3 / 0 / 0
11 / 4.2 / 2.7 / 0.1 / 0.2 / 0.2 / 0.7 / 0.1 / 0.2 / 0 / 0
12 / 2.8 / 1.9 / 0 / 0.4 / 0.2 / 0.1 / 0.1 / 0.1 / 0 / 0
13 / 2.0 / 1.1 / 0.1 / 0 / 0.4 / 0.4 / 0 / 0.1 / 0 / 0
14 / 12.7 / 3.3 / 5.4 / 0.1 / 0.3 / 0.7 / 0.04 / 2.8 / 0 / 0
15 / 4.6 / 1.4 / 1.2 / 0.2 / 0.5 / 0.4 / 0.2 / 0.6 / 0 / 0
16 / 5.5 / 1.5 / 0.2 / 0.3 / 1.3 / 1.6 / 0.1 / 0.6 / 0 / 0
17 / 5.8 / 2.1 / 0 / 0.2 / 1.0 / 2.1 / 0.4 / 0.2 / 0 / 0
18 / 6.5 / 2.1 / 0.2 / 0.5 / 1.1 / 1.9 / 0.5 / 0.2 / 0 / 0

22

Table 9. Mean losses (angular transformed and % (back transformed)) due to fungal rots in stored fruit from unsprayed half of orchard TL109 and receiving full pesticide programme in 2001 prior to treatment applications

Fungal Rot / Means on angular scale / SED (4df) / F-prob / Back-transf. means %
No pesticides / Full programme / No pesticides / Full programme
Total loss / 16.71 / 12.81 / 1.875 / 0.106 / 8.27 / 4.91
Brown rot / 9.78 / 7.85 / 1.294 / 0.210 / 2.89 / 1.87
Phytophthora / 5.00 / 3.61 / 1.840 / 0.493 / 0.76 / 0.40
Botrytis / 2.14 / 2.54 / 0.708 / 0.601 / 0.14 / 0.20
Nectria / 8.41 / 4.21 / 1.593 / 0.058 / 2.14 / 0.54
Gloeospor. / 4.27 / 5.18 / 1.683 / 0.618 / 0.55 / 0.82
Penicillium / 2.47 / 2.00 / 0.972 / 0.652 / 0.19 / 0.12
Phomopsis / 4.74 / 3.66 / 1.039 / 0.360 / 0.68 / 0.41
Botryosp. / 1.29 / 0.00 / 0.423 / 0.038 / 0.05 / 0.00

Table 10. Mean % losses due to rots in stored fruit from unsprayed and sprayed half of orchard TL109 in 2002. Fruit yields were low due to poor set and data below is from bulked treatment plots and unreplicated

Fungal rot / No Pesticides / Full programme
untreated / calcium / urea / untreated / calcium / urea
Total loss / 52.9 / 60.6 / 61.4 / 28.5 / 27.4 / 18.3
Brown rot / 34.4 / 36.5 / 33.9 / 15.7 / 18.7 / 8.5
Phytophthora / 0 / 0 / 0 / 0 / 0 / 0
Botrytis / 0 / 0 / 0.3 / 0 / 0.2 / 1.1
Nectria / 9.7 / 15.8 / 6.2 / 3.8 / 2.0 / 0.8
Gloeospor. / 1.8 / 1.7 / 7.8 / 1.7 / 1.2 / 1.2
Penicillium / 7.1 / 6.2 / 12.4 / 6.7 / 4.8 / 6.8
Phomopsis / 0 / 0 / 0 / 0 / 0 / 0
Botryosp. / 0 / 0.4 / 0 / 0.3 / 0 / 0
Other rot / 0 / 0 / 0.8 / 0.3 / 0.5 / 0

22

Table 11. Mean losses (angular transformed and % (back transformed)) due to fungal rots in stored fruit from half of orchard TL109 receiving full pesticide programme in 2003 and treated with urea, calcium or nil

Fungal rot / Means on angular scale / SED (6df) / F-prob / Back-transf. means - %
Control / Calcium / Urea / Control / Calcium / Urea
Total loss / 32.1 / 23.1 / 32.1 / 4.14 / 0.118 / 28.2 / 15.4 / 28.2
Brown rot / 22.5 / 16.6 / 22.2 / 3.26 / 0.202 / 14.7 / 8.1 / 14.3
Botrytis / 6.02 / 2.70 / 5.18 / 1.362 / 0.113 / 1.10 / 0.22 / 0.81
Nectria / 8.51 / 7.01 / 9.15 / 1.817 / 0.521 / 2.19 / 1.49 / 2.53
Gloeospor. / 8.94 / 6.59 / 8.68 / 1.210 / 0.183 / 2.41 / 1.31 / 2.28
Penicillium / 4.03 / 4.44 / 5.66 / 1.362 / 0.499 / 0.49 / 0.60 / 0.97
Phomopsis / 3.30 / 1.46 / 1.81 / 0.635 / 0.058 / 0.332 / 0.065 / 0.100
Botryosp. / 2.06 / 2.86 / 2.25 / 1.048 / 0.742 / 0.130 / 0.249 / 0.155
Other rots / 0.60 / 1.21 / 1.05 / 1.396 / 0.906 / 0.011 / 0.045 / 0.033
Senescent. rots / 14.1 / 9.8 / 14.5 / 3.16 / 0.317 / 5.98 / 2.87 / 6.26

Table 12. Mean losses (angular transformed and % (back transformed)) due to fungal rots in stored fruit from half of orchard TL109 receiving full pesticide programme in 2004 and treated with urea, calcium or nil.

Fungal rot / Means on angular scale / SED (6df) / F-prob / Back-transf. means - %
Control / Calcium / Urea / Control / Calcium / Urea
Total loss / 12.4 / 8.9 / 12.7 / 2.52 / 0.308 / 4.65 / 2.39 / 4.87
Brown rot / 4.19 / 4.02 / 5.24 / 1.088 / 0.514 / 0.534 / 0.491 / 0.836
Phytophthora / 1.46 / 0.00 / 0.60 / 0.793 / 0.259 / 0.065 / 0.000 / 0.011
Botrytis / 3.50 / 2.06 / 3.63 / 1.036 / 0.315 / 0.373 / 0.130 / 0.400
Nectria / 8.09 / 6.29 / 8.45 / 2.278 / 0.621 / 1.98 / 1.20 / 2.16
Gloeosporium. / 4.43 / 1.81 / 4.90 / 1.249 / 0.096 / 0.597 / 0.100 / 0.728
Penicillium / 2.09 / 1.81 / 1.21 / 0.987 / 0.675 / 0.133 / 0.100 / 0.045
Phomopsis / 2.76 / 0.60 / 1.05 / 0.999 / 0.155 / 0.231 / 0.011 / 0.033
Other rots / 4.25 / 3.42 / 4.66 / 1.229 / 0.616 / 0.549 / 0.356 / 0.659

22

Table 13. Mean numbers of bacterial colony forming units recorded from plant surface washings at various sampling dates from plots sprayed or unsprayed and with or without urea plated out on to Tryptic soy agar in 2002. Figures in brackets are numbers of species recorded in molecular tests

Sample date / Spray programme / Mean number of bacterial colony forming units per ml x 102
Untreated / Urea
Bc / By / Bw / Bp / Bcl / Total cfu / Total types / Bc / By / Bw / Bp / Bcl / Total cfu / Total types
16/4/02
EF / No sprays / 0.3 / 12.8 / 0.4 / 2.1 / 0 / 15.6 / 4 (1) / 0.1 / 0.1 / 16.7 / 0 / 8.3 / 25.2 / 4 (0)
Full sprays / 0.3 / 0.3 / 16.8 / 0.6 / 0 / 18.0 / 4 (2) / 5.1 / 17.4 / 9.1 / 0.7 / 0 / 32.3 / 4 (0)
30/4/02
LF / No sprays / 150 / 5216.7 / 57933.3 / 300 / 0 / 63600 / 4 (2) / 200 / 10483.3 / 61333.3 / 350 / 0 / 72366.7 / 4 (2)
Full sprays / 83.3 / 5900 / 39483.3 / 300 / 0 / 45766.7 / 4 (2) / 216.7 / 10816.7 / 36733.3 / 366.7 / 0 / 48133.3 / 4 (0)
22/5/02
FL / No sprays / 9755 / 507 / 26835.7 / 0 / 0 / 37097.7 / 3 / 12291.7 / 1129.7 / 56493.3 / 0 / 0 / 114785.2 / 3
Full sprays / 71333.3 / 351.8 / 8759.5 / 0 / 0 / 80444.7 / 3 / 10258.3 / 493.2 / 7234 / 0 / 0 / 17985.5 / 3
24/6/02
RL1 / No sprays / 184.7 / 24.3 / 250068.3 / 0 / 0 / 250277.3 / 3 (2) / 368 / 115.3 / 4637.7 / 0 / 0 / 5120.9 / 3 (1)
Full sprays / 268 / 0.7 / 100027.5 / 0 / 0.1 (Bl) / 100296.3 / 4 (3) / 538.7 / 66.8 / 2979.5 / 0 / 0 / 3585.1 / 3 (2)

Table 14. Mean numbers of bacterial colony forming units recorded from plant surface washings at various sampling dates from plots sprayed or unsprayed and with or without calcium plated out on to Tryptic soy agar in 2002. Figures in brackets are numbers of species recorded in molecular tests

Sample date
RL2 / Spray programme / Mean number of bacterial colony forming units per ml x 102
Untreated / Calcium
Bc / By / Bw / Bp / Bl / Total cfu / Total types / Bc / By / Bw / Bp / Bl / Total cfu / Total types
17/7/02 / No sprays / 1405.8 / 530.7 / 51935.4 / 0 / 0 / 53871.9 / 3 (5) / 1684 / 10145.4 / 57589.3 / 0 / 0 / 69418.7 / 3 (3)
Full sprays / 501.5 / 461.6 / 104503.3 / 0 / 0 / 105466.4 / 3 (4) / 309.1 / 250 / 52172.7 / 0 / 8.3 / 52740.1 / 4 (3)
29/8/02
RL3 / No sprays / 1662.5 / 973.8 / 4191.7 / 0 / 0 / 6846.6 / 3 (7) / 415.3 / 1236.3 / 58433.3 / 0 / 0 / 60076.7 / 3 (5)
Full sprays / 571.2 / 655.3 / 4491.7 / 0 / 0 / 5718.1 / 3 (5) / 347.3 / 662.6 / 55333.3 / 0 / 0 / 56107.9 / 3 (3)
16/9/02
RL4 / No sprays / 7141.7 / 1228.7 / 0 / 0 / 0 / 8370.3 / 2 (3) / 7066.7 / 366.7 / 0 / 0 / 0 / 7433.3 / 2 (0)
Full sprays / 6083.3 / 116.7 / 0 / 0 / 0 / 6200 / 2 (0) / 5758.3 / 1108.3 / 0 / 0 / 0 / 6858.3 / 2 (0)

22

Table 15. Mean numbers of bacterial colony forming units recorded from fruit surface washings sampled on 11 September 2002 plated out on to Tryptic soy agar in 2002 Figures in brackets are numbers of species recorded in molecular tests

Spray programme / Bacterial types / Mean number of bacterial colony forming units per ml x 102
Untreated / Urea / Calcium
Bc / By / Total cfu / Total types / Bc / By / Total cfu / Total types / Bc / By / Total cfu / Total types
No sprays / 103015.8 / 2.6 / 103018.4 / 2 (0) / 253750 / 310.9 / 254060.9 / 2 (0) / 252966.7 / 267.7 / 253234.4 / 2 (3)
Full sprays / 204000 / 0.5 / 204000.5 / 2 (2) / 253833.3 / 218.3 / 254051.6 / 2 (0) / 104833.3 / 175.3 / 105008.6 / 2 (0)

Table 16. Mean numbers of yeast colony forming units recorded from plant surface washings at various sampling dates from plots sprayed or unsprayed and with or without urea plated out on to MYGP agar in 2002

Sample date / Spray programme / Yeast types / Mean number of yeast colony forming units per ml x 102
Untreated / Urea
Ypc / Yc / Yr / Yw / Ypfs / Yofs / Total cfu / Total
types / Ypc / Yc / Yr / Yw / Ypfs / Yofs / Total cfu / Total
types
16/4/02
EF / No sprays / 0.5 / 60.3 / 0 / 0 / 0 / 0 / 60.8 / 2 / 0.2 / 0 / 0 / 0 / 0 / 0 / 0.2 / 1
Full sprays / 0.3 / 0 / 0 / 0.1 / 0 / 0 / 0.4 / 2 / 0.1 / 0.1 / 0 / 0 / 0 / 0 / 0.2 / 2
30/4/02
LF / No sprays / 10.4 / 0 / 0.2 / 0 / 0.5 / 8.4 / 19.5 / 4 / 2.2 / 0.2 / 0.1 / 0 / 0.4 / 0.1 / 2.9 / 5
Full sprays / 1.2 / 0.1 / 0.2 / 8.3 / 0.2 / 0 / 9.9 / 5 / 1.9 / 1.2 / 0 / 0.1 / 0 / 0 / 3.2 / 3
22/5/02
FL / No sprays / 1766.7 / 666.7 / 116.7 / 0 / 250 / 0 / 2800 / 4 / 642.8 / 76 / 100.5 / 0 / 164.8 / 0 / 984 / 4
Full sprays / 683.7 / 0.8 / 0.1 / 0 / 8.4 / 0 / 692.9 / 4 / 368.9 / 67.8 / 16.7 / 0 / 8.8 / 0 / 461.8 / 4
24/6/02
RL1 / No sprays / 81.7 / 86.1 / 14.6 / 0 / 34.6 / 2.5 / 219.4 / 5 / 80.7 / 2.2 / 1.6 / 0 / 34.6 / 8.3 / 127.3 / 5
Full sprays / 2.7 / 0.9 / 1 / 0 / 8.8 / 0 / 13.4 / 4 / 24.9 / 26.3 / 1.7 / 0 / 0.2 / 0 / 53.1 / 4

22