Fate and Removal of Various Antibiotic Resistance Genes in Typical Pharmaceutical Wastewater

Supplementarymaterials

Fate and Removal of Various Antibiotic Resistance Genes in Typical Pharmaceutical Wastewater Treatment Systems

Wenchao Zhai1,3,Fengxia Yang2,Daqing Mao1,*,Yi Luo2,*

1School of Environmental Science and Engineering, Tianjin University, Tianjin, 300072, China

2College of Environmental Science and Engineering, Ministry of Education Key Laboratory of Pollution Processes and Environmental Criteria, Nankai University, Tianjin, 300071, China

3Shandong Provincial Solid Waste and Hazardous Chemical Pollution Prevention and Control Center, Jinan, 250117, China

(WenchaoZhai and Fengxia Yang contributed equally to this work)

*Corresponding author:

Yi Luo, Ph.D., Professor. Key Laboratory of Pollution Processes and Environmental Criteria (Ministry of Education), College of Environmental Science and Engineering, Nankai University

No.94, Weijin Road

Tianjin, 300071, China

Phone/Fax: +86 22 23501117

Email:

Daqing Mao, Ph.D., College of Environmental Science and Engineering, Tianjin University

Tianjin, 300072, China

Phone: +86 22 87402072

Email:

1. Detection of antibiotics

1.1 Sample pretreatment and solid-phase extraction of antibiotics

The procedures for samplepretreatment and solid-phase extractionof sludge samples were developedbased on a previous report (Luo et al. 2011). Briefly, 0.5 g lyophilized and sieved sludge sample was spiked witha mixture of four surrogates (25 ng each). The mixture was extracted with 10 mL methanol-EDTA-citrate buffer (V:V:V=3:1:2), vortexed for 1min at 2500 rpm,ultrasonicated for 15 min (50 kHz, 300 W),and then centrifuged at 6140 g for 10 min. The procedure was performed three times, and then the resulting supernatant wascombined withMilli-Q water to reach 500 mL, filteredthrough 0.45μm fiberglass filters, and adjusted to pH 4 with 0.1M HCL. Subsequently, the resulting solution was purified and enriched by SPE using Oasis HLB cartridges (6 mL, 500 mg, Waters, Watford, UK) and a Strata strong anion exchanger (SAX) (3 mL/200 mg, Thermo，USA) cartridge connected in tandem1.2. Ultra-Performance Liquid.

1.2 Chromatography-Tandem Mass Spectrometry Analysis

UPLC-MS/MS analysis was performed. Briefly, the Acquity UPLC BEH C18 column (2.1 100 mm, 1.7 µm particle size; Waters, USA) was maintained at 50 ℃, with injection volumes of 1 μL. Milli-Q water with 0.1% formic acid (v/v) (phase A) and acetonitrile (phase B) were used as mobile phases at a total flow rate of 0.45 mL/min, with the following gradient: 0 min, 90%A; 0∼1.5 min, 90∼84% A; 1.5∼2.0 min, 84∼82% A; 2.0∼2.5 min, 82∼80% A; 2.5∼3.0 min, 80∼78 % A; 30∼4.0 min, 78∼65 % A; 4.0∼4.5min, 65 %∼40 A; 4.5∼5.0 min, 40 % A; 5.0∼6.5 min, 40~5 % A; 6.5∼7.0 min, 5∼90 % A; and 7.0∼10.0 min, 90 % A. The total run time was 10 min, and the last 2.9 min was used to re-equilibrate the column before the next injection.

1.3. Validation of Antibiotics Detection Method

Method recoveries of antibiotics (20 target compounds belong to sulfonamides, quinolones, tetracyclines, macrolides and β-lactams and four surrogates were determined for wastewater and sludge using samples spiked at gradient concentration levels (10ng/L, 50 ng/L, 100 ng/L and 500 ng/L for surface water, 1 ng/g, 10 ng/g, 50 ng/g, 100 ng/g and 500 ng/g for sludge). The recovery (%) from water samples ranged from 70 to 95 for sulfonamides, 63 to 80 for quinolones, 62 to 81 for tetracyclines, 59~80 for macrolide and 62.7-92.7 for β-lactams. The corresponding recovery ranges for sludge samples were 78~95, 57~77, 59~73, 69~72 and 65.3-79.8 respectively. Recoveries of (Trimethyl-13C3 caffeine, meclocycline, sulfadiazine-13C3 and lomefloxacin) for both wastewater and sludge samples were 71%~90%.

The limit of quantification (LOQ) was determined as the lowest concentration which generated a signal to noise ratio (S/N) ≥3 The LOQ for the 20 antibiotics under consideration ranged from 1.5 ng/l for water and from 0.10 to 3.5 ng/g for sludge samples. Reproducibility of response (peak area relative standard deviation (RSD), expressed as % of the mean) was calculated from the average of three replicate injections from each of three replicate samples spiked at gradient concentration levels. The RSD of the 20 compounds ranged from 0.5% to 2.5% for water, and from 0.5% to 5.0% for sludge samples.

2. Qualitative PCR of genes

Qualitative PCR assays were performed to assess the presence of antibiotics resistance genes(ARGs): sulfonamide resistant genes(sul1, sul2, sul3); tetracycline resistant genes(tetO, tetW, tetM, tetQ, tetT, tetS);β-lactam resistant genes(OXA-1, OXA-2, OXA-10, ampC, mecA, CTX-M, TEM,IMP, SME); macrolide resistant genes(ermB, ermC). The primers and corresponding information are listed in Table S1. ARGs amplification was conducted in 25μL reaction volume using a PCR instrument(Bio-Rad, U.S.). Table S2 and Table S3 show the qualitative PCR reaction system and procedure.

TableS1. Primer sequences of the 16S rRNA and twenty-six kinds of ARGs

Gene / Primer (5’ – 3’) / Fragment size(bp) / Annealing temperature
(℃) / reference
16S / Forward / CGGTGAATACGTTCYCGG / 123 / 55 / Suzuki et al., 2000
Reverse / GGWTACCTTGTTACGACTT
sul1 / Forward / CGCACCGGAAACATCGCTGCAC / 163 / 55 / Pei et al., 2006
Reverse / TGAAGTTCCGCCGCAAGGCTCG
sul2 / Forward / TCCGGTGGAGGCCGGTATCTGG / 191 / 55 / Pei et al., 2006
Reverse / CGGGAATGCCATCTGCCTTGAG
sul3 / Forward / TCCGTTCAGCGAATTGGTGCAG / 128 / 55 / Pei et al., 2006
Reverse / TTCGTTCACGCCTTACACCAGC
tetO / Forward / ACGGARAGTTTATTGTATACC / 171 / 45 / Yuet al., 2015
Reverse / TGGCGTATCTATAATGTTGAC
tetW / Forward / GAGAGCCTGCTATATGCCAGC / 168 / 60 / Yuet al., 2015
Reverse / GGGCGTATCCACAATGTTAAC
tetM / Forward / ACAGAAAGCTTATTATATAAC / 171 / 45 / Yuet al., 2015
Reverse / TGGCGTGTCTATGATGTTCAC
tetQ / Forward / AGAATCTGCTGTTTGCCAGTG / 169 / 60 / Ng et al., 2001
Reverse / CGGAGTGTCAATGATATTGCA
tetT / Forward / AAGGTTTATTATATAAAAGTG / 169 / 45 / Aminov et al., 2001
Reverse / AGGTGTATCTATGATATTTAC
tetS / Forward / GGTCAACGGCTTGTCTATGTA / 607 / 55.7 / Yuet al., 2015
Reverse / CCAGGCTCTCATACTGAATGC
ermB / Forward / CGTGCGTCTGACATCTATCTGA / 190 / 56.8 / Yuet al., 2015
Reverse / CTGTGGTATGGCGGGTAAGTT
ermC / Forward / GAAATCGGCTCAGGAAAAGG / 291 / 57 / Grahom et al., 2011
Reverse / TAGCAAACCCGTATTCCACG
OXA-1 / Forward / TATCTACAGCAGCGCCAGTG / 199 / 60 / Yang et al., 2012
Reverse / CGCATCAAATGCCATAAGTG
OXA-2 / Forward / TCTTCGCGATACTTTTCTCCA / 177 / 60 / Yang et al., 2012
Reverse / ATCGCACAGGATCAAAAACC
OXA -10 / Forward / AGAGGCTTTGGTAACGGAGG / 191 / 60.5 / Yang et al., 2012
Reverse / TGGATTTTCTTAGCGGCAAC
ampC / Forward / CCTCTTGCTCCACATTTGCT / 189 / 58 / Yang et al., 2012
Reverse / ACAACGTTTGCTGTGTGACG
mecA / Forward / TAATAGTTGTAGTTGTCGGGTTTG / 733 / 60 / Yang et al., 2012
Reverse / TAACCTAATAGATGTGAAGTCGCT
CTX-M / Forward / SCSATGTGCAGYACCAGTAA / 543 / 55 / Yang et al., 2012
Reverse / CCGCRATATGRTTGGTGGTG
TEM / Forward / CATTTTCGTGTCGCCCTTAT / 167 / 58 / Yang et al., 2012
Reverse / GGGCGAAAACTCTCAAGGAT
IMP / Forward / CTACCGCAGCAGAGTCTTTG / 607 / 55 / Yang et al., 2012
Reverse / AACCAGTTTTGCCTTACCAT
SME / Forward / AACGGCTTCATTTTTGTTTAG / 850 / 55 / Yang et al., 2012
Reverse / GCTTCCGCAATAGTTTTATCA

TableS2.Qualitative PCR reaction system

solvent / volume/μl (final concentration)
10×buffer(Mg2+) / 2.5
dNTPs / 2.0 (250 μM)
Tag polymerase / 0.25 (1.25U)
Primer-F / 0.5 (1.5 μM)
Primer-R / 0.5 (1.5 μM)
ddH20 / 18.25
Template / 1.0

Table S3.Qualitative PCR procedure

Stage / Temperature(℃) / time
Total DNA denaturation / 95 / 5min
DNA denaturation / 96 / 30s
Annealing / ARGs annealing temperature / 30s 35 times
Stretching / 72 / 1min/1kb
Final extension / 72 / 7min

3. Steps of makingcalibration standard curves

Making standard curves is essential for quantitative genes to get the ARGs concentration. The process of making standard curve is as follows: the PCR product of the target gene from the samples was recovered using AxyPrepTM DNA Gel Extraction Kit. Then the recovered DNA was mixed with the cloning solution containing the vectors that can be connected with the foreign genes using PMD 18-T Simple Vector kit. In this way, the target genes could connect with vector. Then the mixture should be transformed to the competent cells(Trans1-T1 Phage Resistant Chemically Competent Cell). After that, bacteria would grow on the culture medium with antibiotic resistance to verify that the ARGs had been transformed into the bacteria. What’s more, bacteria should be cultured in the liquid medium to expand culture for increasing the bacteria numbers that contains target ARGs. After that, plasmid that contained the target ARG is extracted using E.Z.N.A.TM Plasmid Mini Kit Ⅰ. Last, the plasmid DNA solution is diluted to different range of concentration with the concentration of DNA has been determined using nucleic acid analyser for qPCR to get the standard curve.5. Quantitative PCR of genes

Abundance of 16S rRNA and ARGs, including sulfonamide resistant genes(sul1, sul2, sul3), tetracycline resistant genes(tetO, tetW, tetM, tetQ, tetT),β-lactam ARGs(OXA-1, OXA-2, OXA-10) and macrolide resistant genes(ermB), which were selected according qualitative PCR results, were quantified in a 25μL reaction system. The primers which were used in the quantitative PCR were the same with those used in qualitative PCR.The PCR was performed in optimized reaction condition, Table S4 and Table S5 show the quantitative PCR reaction system and procedure.

Table S4.Quantitative PCR reaction system

solvent / volume/μl (final concentration)
Primer-F / 0.5 (0.25 μM)
Primer-R / 0.5 (0.25 μM)
2×TransStartTM Top Green qPCR SuperMix / 12.5
Passive Reference Dye / 0.5
Template / 1.0
ddH2O / 10

Table S5.Quantitative PCR procedure

Stage / Temperature(℃) / time
Total DNA denaturation / 94 / 30s
DNA denaturation / 94 / 5s
Annealing / ARGs annealing temperature / 15s 45 times
Stretching / 72 / 10 +Plate Read
Dissociation Stage / 94 / 30
55 / 30
Melt Curve 55 to 95, increment：0.5 / 0.05+Plate Read

4.Table S6. Concentration of gene in the effluent of each stage of pharmaceutical wastewater treatment plant.

ARGs / Each stage of plant A
①BT / ②SBR / ③B-COT / ④DAFT / ⑤COT / DS
16S / (2.60.7)108 / (3.20.6)108 / (1.80.4)108 / (1.30.2)108 / (4.21.2)107 / (5.91.3)1010
sul1 / (2.70.5)107 / (2.20.5)107 / (1.60.4)107 / (8.50.6)106 / (6.21.2)106 / (1.50.2)1010
sul2 / (3.00.5)107 / (1.10.3)108 / (9.20.4)107 / (3.90.3)107 / (2.40.1)107 / (2.70.4)1010
tetO / (6.11.6)104 / (1.10.3)104 / (8.75.8)103 / (2.10.1)103 / (2.00.6)103 / (1.20.1)107
tetM / (1.40.4)107 / (5.81.3)107 / (3.30.9)107 / (9.02.1)106 / (3.80.8)106 / (2.10.2)1010
tetQ / (9.11.2)104 / (4.12.1)105 / (3.20.3)105 / (1.20.1)105 / (6.10.6)104 / (1.40.1)1010
tetW / (2.30.1)107 / (5.41.7)107 / (3.70.6)107 / (1.40.3)107 / (8.31.0)106 / (1.40.3)1010
tetT / (4.10.2)104 / (1.30.0)106 / (1.00.1)104 / (5.81.8)103 / (1.30.3)103 / (4.40.3)106
OXA-1 / (4.90.1)107 / (4.50.3)107 / (2.00.3)107 / (1.30.2)107 / (9.01.0)106 / (4.30.1)1010
OXA-10 / (5.10.3)105 / (4.81.1)105 / (4.81.6)105 / (1.10.1)105 / (8.70.3)104 / (3.90.2)109
ermB / (2.60.1)107 / (3.10.7)107 / (2.51.3)107 / (1.30.4)107 / (8.22.5)106 / (1.40.1)109
ARGs / Each stage of plant B
①BT / ②PCT / ③AeT / ④SCT / ⑤AT
16S / (1.10.1)108 / (2.00.6)107 / (9.00.2)108 / (4.30.4)106 / (7.70.8)108
sul1 / (2.71.4)106 / (8.21.4)105 / (7.21.3)107 / (7.51.2)105 / (9.00.6)107
sul2 / (2.00.5)106 / (8.52.0)105 / (8.50.1)106 / (1.10.2)105 / (7.12.1)106
tetO / (4.91.3)103 / (1.20.5)103 / (8.60.6)104 / (1.00.2)102 / (6.00.6)104
tetM / (4.61.7)104 / (7.82.9)103 / (1.00.4)106 / (1.60.2)102 / (8.00.3)105
tetQ / (1.40.1)105 / (3.61.0)104 / (1.80.1)106 / (1.80.2)104 / (1.20.1)106
tetW / (2.90.5)106 / (8.01.4)105 / (3.70.1)107 / (3.60.3)104 / (4.00.8)107
OXA-1 / (6.60.3)106 / (2.40.4)106 / (7.60.2)107 / (1.60.5)105 / (5.20.2)107
OXA-2 / (5.32.0)106 / (8.53.9)105 / (5.90.9)107 / (2.10.2)104 / (5.32.6)107
OXA-10 / (1.50.5)107 / (6.32.4)106 / (1.80.2)108 / (8.84.3)104 / (3.00.3)108
ermB / (2.91.1)107 / (1.10.2)107 / (1.10.1)108 / (3.00.4)106 / (2.40.2)108
ARGs / Each stage of plant B
⑥AeT / ⑦SCT / ⑧COT / 1#DS / 2#DS
16S / (4.40.1)108 / (1.40.1)107 / (3.02.1)106 / (1.20.1)109 / (5.81.3)109
sul1 / (9.10.2)107 / (1.50.5)105 / (1.40.4)105 / (1.70.5)108 / (1.40.3)109
sul2 / (1.30.1)107 / (7.81.3)104 / (1.90.2)104 / (1.30.0)109 / (8.80.8)108
tetO / (7.00.4)104 / (6.40.7)101 / (2.60.1)101 / (1.10.3)105 / (1.60.1)105
tetM / (7.40.4)105 / (5.12.1)102 / (3.90.4)102 / (1.30.1)107 / (9.50.8)106
tetQ / (2.30.1)106 / (4.21.0)103 / (8.11.9)102 / (6.30.6)107 / (2.20.7)107
tetW / (3.50.6)107 / (1.20.1)104 / (1.20.3)104 / (8.30.4)107 / (1.10.2)108
OXA-1 / (6.10.3)107 / (9.70.5)104 / (2.30.3)104 / (1.20.1)108 / (5.90.6)108
OXA-2 / (4.01.4)107 / (7.21.8)103 / (1.60.3)103 / (1.20.3)108 / (1.30.2)108
OXA-10 / (2.80.2)108 / (2.41.1)105 / (1.10.4)105 / (5.30.5)108 / (1.10.3)109
ermB / (2.10.1)108 / (2.50.7)106 / (1.10.2)106 / (7.30.4)108 / (1.10.1)109

Abbreviations: BT: balance tank, SBR: sequence bath reactor, B-COT: bio-contact oxidation tank, DAFT: dissolved air floating tank, COT: chemical oxidation tank, EF:effluent, RS: returned sludge, ES: excess sludge, PCT: primary clarifier tank, AeT: aeration tank , SCT: secondary clarifier tank, AT: anoxic tank, DS: dewatered sludge.1#DS comes from ④SCT, 2#DS comes from ⑦SCT.

5. Table S7.Relative concentration of gene in the effluent of each stage at two PWWTPs.

genes / each stage of plant A
①BT / ②SBR / ③B-COT / ④DAFT / ⑤COT / S
suls / 3.26E-01 / 2.03E-01 / 3.04E-01 / 1.90E-01 / 3.58E-01 / 3.46E-01
tets / 8.40E-02 / 7.14E-02 / 7. 87E-02 / 3.66E-02 / 5.82E-02 / 1.62E-01
OXAs / 2.80E-01 / 7.08E-02 / 5.61E-02 / 5.17E-02 / 1.10E-01 / 3.93E-01
erms / 1.82E-01 / 9.87E-02 / 1.40E-01 / 1.02E-01 / 1.98E-01 / 2.31E-01
genes / each stage of plant B
①BT / ②PCT / ③AeT / ④SCT / ⑤AT / ⑥AeT / ⑦SCT / ⑧COT / 1#S / 2#S
suls / 2.17E-02 / 4.08E-02 / 4.45E-02 / 9.86E-02 / 6.31E-02 / 1.17E-01 / 8.03E-03 / 2.61E-02 / 6.13E-01 / 1.93E-01
tets / 6.93E-03 / 1.03E-02 / 1.07E-02 / 3.10E-03 / 1.36E-02 / 2.09E-02 / 2.94E-04 / 1.08E-03 / 2.98E-02 / 5.80E-03
OXAs / 8.09E-02 / 1.55E-01 / 1.16E-01 / 2.10E-02 / 1.74E-01 / 2.85E-01 / 8.03E-03 / 1.47E-02 / 2.12E-01 / 1.03E-01
erms / 2.62E-01 / 5.15E-01 / 1.21E-01 / 6.90E-01 / 3.16E-01 / 4.77E-01 / 1.75E-01 / 3.61E-01 / 5.97E-01 / 1.86E-01

6.Significant correlation between 16SrRNA and ARGs in each stage of pharmaceutical wastewater treatment systems.

Figure S1. Correlation analysis between the concentration of 16S rRNA gene and antibiotic resistant genes at Plant A and Plant B.

Reference

Aminov RI, Garrigues-Jeanjean N, Mackie RI（2001）Molecular ecology of tetracyclineresistance: Development and validation of primers for detection of tetracyclineresistance genes encoding ribosomal protection proteins. Appl Environ Microbiol 67(1):22-32

Cattoir V, Poirel L, Rotimi V, Soussy C-J, Nordmann P (2007)Multiplex PCR fordetection of plasmid-mediated quinolone resistance qnr genes in ESBL-producingenterobacterial isolates.J AntimicrobChemother 60: 394-397

Cummings DE, Archer KF, Arriola DJ, Baker PA, Faucett KG, BLaroya J, L.Pfeil K, R. Ryan C, R URyan K, E. Zuil D (2011) Broad Dissemination ofPlasmid-Mediated Quinolone Resistance Genes in Sediments of Two Urban CoastalWetlands. Environmental Science & Technology 45(2):447-454

Grahom DW, Olivares-Rieumont S, Knapp CW, Lima L, Werner D, Bowen E (2011) Antibiotic resistance geneabundances associated with waste discharges into the Almendares River near Havana,Cuba. Environmental Science & Technology 45(2):418-424

Kim HB, Wang MH, Park CH, Kim E-C, A. Jacoby G, C. Hooper D (2009)oqxAB encoding a multidrug efflux pump in human clinical isolates of Enterobacteriaceae.Antimicrob Agents Chemother, 53: 3582-3584

Ng L-K,MartinI,AlfaM,Mulvey M (2001) Multiplex PCR for the detection of tetracyclineresistant genes. Molecular and Cellular Probes, 15(4):209-215

Pei R, Kim SC, Carlson KH, Pruden A (2006) Effect of River Landscape on the sedimentconcentrations of antibiotics and corresponding antibiotic resistance genes (ARG).Water Research, 40(12): 2427-2435

Suzuki MT,Taylor LT,DeLong EF (2000) Quantitative analysis of small-subunit rRNA genes in mixed microbial populations via 5 '-nuclease assays. Appl Environ Microbiol, 66(11): 4605-4614

Xia LN, Li L, Wu CM, Liu YQ, Tao XQ, Dai L, Qi YH, Lu LM, Shen JZ (2010) A survey ofplasmid-mediated fluoroquinolone resistance genes from Escherchia coli isolates andtheir dissemination in Shandong, China. Foodborne Pathog Dis, 7: 207-215

YangY, Zhang T, Zhang XX, Liang D-W, Zhang M, Gao DW, Zhu HG, Huang QG, Fang HHP (2012) Quantification and characterization ofβ-lactamresistance genes in 15 sewage treatment plants from East Asia and North America. ApplMicrobiolBiotechnol, 95(5): 1351-1358

Mao DQ, Yu S, Rysz M, Luo Y, Yang FX, Li FX, Hou J, Mu QH, Alvarez PJJ (2015) Prevalence and proliferation of antibiotic resistance genes in two municipal wastewater treatment plants. Water res, 85: 458-466