Honors Biology
Chapter 10 – Homework Assignment Name ______
Transcription and Translation Problems
1. If DNA contained only the bases adenine and thymine, how long a code word would be necessary to enable coding for each of the 20 different amino acids?
2. Give the following DNA molecule; write the sequence of the messenger RNA synthesized if RNA polymerase reads the top strand.
3’ – TACGGTAAAACT – 5’
5’ – ATGCCATTTTGA – 3’
a. mRNA:
b. Indicate the 5’ and 3’ ends of the message.
c. Groups of three letters on the mRNA molecule are called ______.
d. What is the special significance of the first group of three letters in the message?
e. What is the special significance of the last group of three letters in the message?
3. A particular DNA base sequence transcribed into messenger RNA is UUAUCUUCGGGAGAGAAAACA
a. If reading beings at the left, what amino acids are coded by this sequence? (Note: the start codon is disregarded in this example.)
b. If exposure to a chemical caused deletion of the first adenine nucleotide on the left, what changes would occur in the first six amino acids coded by this sequence?
4. Using the codon table in your book, determine the resulting protein sequence and the original DNA sequence which produced the following mRNA sequence:
a. mRNA:
b. Protein sequence:
c. DNA sequence:
d. Complementary DNA strand for this sequence:
5. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader sequence may precede the AUG initiation codon.)
3’-AGATTACTCGAGCCGGGTAATCGGC-5’
a. mRNA:
b. Protein:
6. If a eukaryotic promoter sequence is AATTAATATA, given the following piece of DNA, first transcribe the DNA and then translate the resultant mRNA.
5’-GCCCAGAATTAATATACGGATGTGGATGTCCTGATTTATCCGCCTCTTAATCTATATG-3’
3’-CGCCTCTTAATTATATGCCTACACCTACAGGACTAAATAGGCGGAGAATTAGTATATA-5’
a. mRNA:
b. Protein:
7. Answer the following questions regarding mutation of a gene and the effect they would have on the protein produced from that gene:
a. Substitution of a nucleotide in the exon
b. Substitution of a nucleotide in an intron
c. Substitution of a nucleotide in the third position of a codon in an exon
d. Deletion of a nucleotide in an exon
8. The following segment of DNA codes for a protein. The uppercase letters represent exons. The lower-case letter represent introns. The lower strand is the template strand.
a. Why could this gene not have been found in a prokaryotic cell?
b. Transcribe the DNA into a primary transcript. Then write in the sequence of the mature mRNA sequence. Finally, translate the sequence.
GCTAAATGGCAaaattgccggatgacGCACATTGACTCGGaatcgaGGTCAGATGC
CGATTTACCGTtttaacggcctactgCGTGTAACTGAGCCttagctCCAGTCTACG