Role of AMP-activated Protein Kinase α1 in 17α-Ethinylestradiol-induced Cholestasis in Rats
Arch Toxicol
Xiaojiaoyang Li, Runping Liu, Lan Luo, Linxi Yu, Xin Chen, Lixin Sun, Tao Wang, Phillip B. Hylemon, Huiping Zhou, Zhenzhou Jiang, and Luyong Zhang
Address correspondence to:
Luyong Zhang, Ph.D
Jiangsu Key Laboratory of Drug Screening
China Pharmaceutical University
Nanjing, Jiangsu, China 210009
Tel: 86-25-83271500; Fax: 86-25-83271500
Email:
Or
Zhenzhou Jiang, Ph.D
Jiangsu Center for Pharmacodynamics Research and Evaluation
China Pharmaceutical University
Nanjing, Jiangsu, China 210009
Tel: 86-25-83271142; Fax: 86-25-83271142
Email:
Or
Huiping Zhou, Ph.D
Department of Microbiology & Immunology
Virginia Commonwealth University
P.O. Box 980678, Richmond, VA 23298-0678
Tel: 804-828-6817; Fax: 804-828-0676
Email:
1. Online Resource Materials and Methods
Materials. 17α-Ethinylestradiol (EE) was obtained from Tokyo chemical industry (Tokyo, Japan). AICAR, STO-609, Compound C (CC), Rat type I collagen, type I collagenase and other cell culture supplement components were purchased from Sigma (MO, USA). U0126, H89, ICI182,780 and GW4064 were from Selleck Chemicals (TX, USA). G15 was purchased from Cayman Chemical (MI, USA). TRIzol reagent and William’s E medium were products from Invitrogen (CA, USA). High-Capacity cDNA Reverse Transcription kit was from Applied Biosystems (CA, USA). Scientific Luminaris Color SYBR green qPCR Master Mix was purchased from Thermo (DE, USA). Cell Counting Kit-8 (CCK-8) was from Dojindo Molecular Technologies (Kumamoto, Japan). O.C.T gel was from Sakura Finetek (CA, USA).
Cell viability assay. Rat primary hepatocytes were plated in 24-well plates and treated with different concentrations of EE (0, 1, 10, 50, 100, or 200 µM) for 48-hour. At the end of treatment, cell viability was assayed using the Cell Counting Kit-8 (CCK-8) from Dojindo Molecular Technologies, Inc. Absorbance readings were made at A450nm with a microplate reader from Tecan (Austria GmbH, Austria).(Liu et al. 2014)
Measurement of the liver functional enzyme activities and total bile acid levels and histologic analysis and staining. Serum levels of alkaline phosphatase (ALP), lactatedehydrogenase (LDH), aspartate aminotransferase (AST), alanineaminotransferase (ALT), and total bile acid (TBA) were directly measured by individual assay kit from Weiteman (China). Liver samples or hepatocytes were homogenized in RIPA buffer. Total protein lysates were used for analysis. Results were normalized with total protein concentration. The biliary concentration of TBA and Phospholipid was measured by assay kit from Wako Pure Chemical Industries (Osaka, Japan). Liver histology by H&E staining was performed as described previously.(Wu et al. 2010)
ADP/ATP ratio assay. Hepatocytes were plated in the 96-well white (opaque) plates with clear bottoms and then treated with EE for different time periods. ADP/ATP ratio was measured with an ADP/ATP Ratio Assay Kit (Sigma-Aldrich, USA).
Quantitative real-time RT-PCR. Total RNA from hepatocytes and rat livers was isolated by TRIzol reagent (Invitrogen, CA, USA). A total of 2 μg of RNA was reverse transcribed to first-strand cDNA using Takara PrimeScript Reverse Transcriptase (Osaka, Japan). Quantitative real-time RT-PCR was performed with Thermo Scientific Luminaris Color SYBR green qPCR Master Mix using Bio-Rad iQ5. GAPDH was used as an internal control. All primers used were listed in online supplementary Table 1.
Immunofluorescence staining. Rat liver frozen sections were immobilized with 4% paraformaldehyde, washed with PBS and permeablized in 0.1% Triton X-100. After incubation with primary antibodies overnight at 4°C, the appropriate Alexa Fluor-conjugated secondary antibodies were used. Hoechst was used as a nuclear stain. Fluorescence images were obtained using Olympus IX81 motorized inverted fluorescence microscope with 40 x lens.
Immunoprecipitation. Rat liver tissues were lysed with RIPA buffer. Total 500 μg of protein lysate was pre-cleared with protein A-Sepharose beads for 1 hour at 4°C. The supernatant was incubated with 2 μg of primary antibodies and protein A beads overnight at 4°C on a rolling wheel. The immune complex was washed with RIPA buffer 5 times. The immunoprecipitated proteins were analyzed by Western blot analysis.
Lentiviral shRNA for AMPKα1 and AMPKα2. The lentiviral vectors containing the stem loop sequences of short hairpin RNA (shRNA) specifically targeting rat AMPKα1, AMPKα2 and scrambled control sequence were designed and produced by Genepharma (Shanghai, China). The sequences of AMPK shRNA and control shRNA are as followings: AMPKα1 shRNA: (1) GCTTGATGCACACATGAATGC; (2) GCTGCACCAGAAGTAATTTCA; (3) GGAAGTTCTCAGCTGTCTTTA; (4) GCGTGTACGAAGGAAGAATCC; control shRNA: TTCTCCGAACGTGTCACGT. AMPKα2 shRNA: (1) GCGGCTCTTTCAGCAGATTCT; (2) GCAGGTCCTGAAGTTGATATC. Sandwich cultured rat primary hepatocytes were exposed to lentiviruses at a multiplicity of infection (MOI) of 20 for 30-hour with 8 μg/mL polybrene. After 30-hour transduction, culture medium of hepatocytes was replaced and cells were treated with EE (10 μM) for 2 or 24-hour. Total protein and RNA were isolated for Western blot and real-time RT-PCR analysis.
Lentiviral overexpression for FXR. The lentiviral vectors for specifically targeting rat FXR expression and scrambled control sequence were designed and produced by Genepharma (Shanghai, China). Ad-Nr1h4 (FXR) was generated by cloned full-length rat Nr1h4 cDNA into a lentivirus transfection vector (EF1a/Puro). Rat primary hepatocytes were transfected with the overexpression virus, as described previously.
2. List of primers used for RT-PCR
Real-time RT-PCR primers
Name / Forward (5’ to 3’) / Reverse (5’ to 3’)FXR / TGGACTCATACAGCAAACAGAGA / GTCTGAAACCCTGGAAGTCTTTT
Bsep / TGGAAAGGAATGGTGATGGG / CAGAAGGCCAGTGCATAACACA
Mrp2 / ACTTGTGACATCGGTAGCATG / GTGGGCGAACTCGTTTTG
Ntcp / GCATGATGCCACTCCTCTTATAC / TACATAGTGTGGCCTTTTGGACT
Oatp2 / TGTGATGACCGTTGATAATTTTCCA / TTCTCCACATATAGTTGGTGCTGAA
AMPKα1 / GGGATCCATCAGCAACTATCG / GGGAGGTCACGGATGAGG
AMPKα2 / CATTTGTGCAAGGCCCCTAGT / GACTGTTGGTATCTGCCTGTTTCC
GAPDH / ATGGAGAAGGCTGGGGCTCACCT / AGCCCTTCCACGATGCCAAAGTTGT
3. List of antibodies used for western blots/immunofluorescence
Antibodies against Bsep (F-6, sc-74500), Mrp2 (H-17, sc-5770), Ntcp (M-130, sc-98485), Oatp2 (A-2, sc-376424), p-PKA (Thr-198, sc-32968), PKA (H-56, sc-98951), p-ERK (E-4, sc-7383), ERK1 (C-16 ,sc-93), ERK2 (C-14, sc-154), AMPK α1 (C-20, sc-19128), AMPK α2 (C-20, sc-19131), β-actin (AC-15, sc-69879), HRP-conjugated goat anti-mouse IgG (sc-2005), HRP-conjugated goat anti-rabbit IgG (sc-2004) and HRP-conjugated rabbit anti-goat IgG (sc-2768) antibodies were from Santa Cruz Biotechnology (CA, USA). Antibody against FXR (bs-12867R) was from Bioss (MA, USA). Alexa Fluor 594 Donkey anti-mouse lgG antibody (R37115) and Alexa Fluor 594 Donkey anti-goat lgG antibody (A11058) were from Invitrogen Life Science (CA, USA). Antibodies against p-LKB1 (C67A3, 3482), LKB1 (D60C5, 3047), p-AMPK (Thr-172, 2531), AMPK (2532), p-CAMKII (D21E4, 12716), CAMKII (D11A10, 4436), p-ACC (Ser-79, 3661), ACC (3662) and Lamin B (D4Q4Z, 12586) were from Cell Signaling Technology (MA, USA).
Online Resource Fig. 1 Effect of EE on cAMP-ERK-LKB1 pathways. a, d Rat primary hepatocytes were treated with EE (10 μM) for different time periods or b, e different concentrations of EE for 2-hour. Representative immunoblots against p-ERK1/2 and p-LKB1 are shown and normalized with T-ERK1/2 and T-LKB1, respectively. c Intracellular cAMP level in rat primary hepatocytes treated with different concentrations of EE for 10-minute was determined by HTRF assay. *P<0.05, ** P<0.01, *** P<0.001 vs. control group
Online Resource Fig. 2 Effect of CaMKK and PKA on EE-induced AMPK activation. a Rat primary hepatocytes were treated with EE (10 μM) with the presence or absence of CaMKK pathway inhibitor STO-609 (1μM) for 2-hour. b, c Rat primary hepatocytes were treated with EE (10 μM) with the presence or absence of a PKA inhibitor H89 (30 μM) for 2-hour. Representative immunoblots against p-AMPK, T-AMPK, p-PKA, and T-PKA are shown and normalized with total T-AMPK and T-PKA, respectively. d Rat primary hepatocytes were treated with 10 μM EE for different time periods as indicated. Intracellular ADP and ATP levels were measured with ADP/ATP Ratio Assay kit. *P<0.05 vs. control group; #P<0.05 vs. EE group
Online Resource Fig. 3 Effect of EE on cell viability and bile acids accumulation in hepatocytes. Rat primary hepatocytes were treated with different concentrations of EE (0 to 200 μM) for 24-hour. a Relative cell viability determined by CCK-8 and normalized to control group (n=6). b The enzyme activity of ALT, AST and LDH; c The enzyme activity of ALP; d Total bile acids (TBA) levels were measured using commercial assay kits (n=6). *P<0.05, ** P<0.01 and *** P<0.001 vs. control group
Online Resource Fig. 4 Effect of 17α-Ethinylestradiol (EE) on bile acid transporters. a The relative mRNA levels of major hepatic transporters in rat primary hepatocytes treated with EE (0 to 100 μM) for 24-hour were determined by real-time RT-PCR and normalized using GAPDH as an internal control. b, c Representative immunoblots against Bsep, Mrp2, Ntcp, Oatp2 and β-actin are shown and normalized with β-Actin. *P<0.05, **P<0.01, ***P<0.001 vs. control group
Online Resource Fig. 5 Effect of U0126 on EE-induced down-regulation of FXR in rat primary hepatocytes. a, b Rat primary hepatocytes were pretreated with U0126 (10 μM) for 1 hour, and then treated with EE (10 μM) for 24-hour. a The relative mRNA level of FXR was determined by real-time RT-PCR and normalized using GAPDH as an internal control. b The protein level of FXR was detected by Western blot analysis and normalized with β-Actin. *P<0.05, **P<0.01, ***P<0.001 vs. control group; #P<0.05, ##P<0.01 vs. EE group
Online Resource Fig. 6 Role of GRP30 in EE-induced AMPK activation and down-regulation of bile acid receptors Rat primary hepatocytes were pretreated with GRP30 receptor antagonist G15 (1 μM) for 15-minute and then treated with EE (10 μM) for 2 a or 24-hour b, c. a, b Representative immunoblots against p-AMPK and FXR are shown and normalized with T-AMPK and β-actin, respectively. c The relative mRNA levels of relative genes were normalized using GAPDH as an internal control. *P<0.05, ***P<0.001 vs. control group; #P<0.05 vs. EE group
Online Resource Fig. 7 Role of ER in EE-induced AMPK activation and down-regulation of bile acid receptors. Rat primary hepatocytes were pretreated with estrogen receptor antagonist ICI186,780 (100 nM) for 30-minute and then treated with EE (10 μM) for 2 a or 24-hour b-d. a, b Representative immunoblots against p-AMPK and FXR are shown and normalized with T-AMPK and β-actin, respectively. c The relative mRNA levels of relative genes were normalized using GAPDH as an internal control. *P<0.05, ***P<0.001 vs. control group; #P<0.05 vs. EE group
Online Resource Fig.8 Protective effect of Compound C on EE-induced cholestasis in rat model. Bile and liver tissues were collect for analysis as described in Methods. a Hepatic TBA levels and b biliary phospholipid levels in rats treated with EE with or without CC. c Representative immunoblots against p-AMPK and FXR are shown and normalized with T-AMPK and β-actin, respectively. d Representative images of immunofluorescence staining of Bsep (Red) and Mrp2 (Red) are shown. ***P<0.001 vs. control group, n=6; ###P<0.001 vs. EE group
Online Resource Fig. 9 Effect of AMPKα2 knock down on EE-induced cholestasis in rat primary hepatocytes. a Rat primary hepatocytes were transduced with lentivirus shRNA targeting AMPKα2 (α2-shRNA) or negative control lentivirus (C-shRNA) for 24-hour. Representative immunoblots against AMPK subunits are shown and normalized with β-Actin. b, c Rat primary hepatocytes were transduced with α2-shRNA or C-shRNA for 24-hour, then treated with EE (10 μM) for 24-hour. b The mRNA levels of FXR, and c the relative mRNA levels of Bsep, Mrp2, Ntcp and Oatp2 were determined by real-time RT-PCR and normalized using GAPDH as an internal control. *P<0.05, **P<0.01 and ***P<0.001 vs. control group
References:
Liu R, Zhao R, Zhou X, et al. (2014) Conjugated bile acids promote cholangiocarcinoma cell invasive growth through activation of sphingosine 1-phosphate receptor 2. Hepatology 60(3):908-918
Wu X, Sun L, Zha W, et al. (2010) HIV protease inhibitors induce endoplasmic reticulum stress and disrupt barrier integrity in intestinal epithelial cells. Gastroenterology 138(1):197-209 doi:10.1053/j.gastro.2009.08.054