Supplementary figure 1. Melting curves of qRT-PCR product of verified circRNAs. Melting curve analysis of qRT-PCR product of hsa_circ_0000520, hsa_circ_0005075 and hsa_circ_0066444 respectively indicate the specificity of qRT-PCR product with no primer dimers or nonspecific amplified product.

Supplementary figure 2. Detailed annotation for the circRNA/miRNA interaction. The 5 highest ranking candidate miRNA binding targets (“Top 5”) of hsa_circ_0005075 were predicted by miSVR. The molecular interaction of hsa_circ_0005075 with its miRNA targets was based on complementary base pairing principle.

Supplementary Table 1. Clinical characteristics of three microarray analysis samples.

Characteristics / No.of patients(%)
Sex
Female / 1 (33.33%)
male / 2 (66.67%)
Age (year)
≤60 / 2 (66.67%)
＞60 / 1 (33.33%)
Serum AFP
Negative / 1 (33.33%)
Positive / 2 (66.67%)
HBsAg
Negative / 1 (33.33%)
Positive / 2 (66.67%)
Cirrhosis
present / 2 (66.67%)
absent / 1 (33.33%)
Tumor size
>5cm / 1 (33.33%)
≤5cm / 2 (66.67%)
Differentiation
Well & Moderate / 2 (66.67%)
Poor / 1 (33.33%)
TNM stage
0 & I & II / 2 (66.67%)
III & IV / 1 (33.33%)
Tumor number
Single / 3 (100%)
Multiple / 0 (0)
Tumor encapsulation
complete / 2 (66.67%)
incomplete / 1 (33.33%)
Microvascular invasion
absent / 2 (66.67%)
present / 1 (33.33%)
ALT
Negative / 0 (0)
Positive / 3 (100%)
GGT
Negative / 1 (33.33%)
Positive / 2 (66.67%)

Supplementary Table 2. Divergent primers sequences for circRNAs

CircRNAs / Primers sequence
hsa_circ_0000520 / F:5’GTCTGAGACTAGGGCCAGAGGC3’
R:5’GACATGGGAGTGGAGTGACAGG3’
hsa_circ_0066444 / F:5’GAACGGTTTCCAGATTTGAGC3’
R:5’TCGTTTGCGGTGTATCCATT3’

Supplementary Table 3.

P-value and FDR / Fold change and Regulation / Annotations / Group--Raw Intensity / miRNA Binding Sites
probeID / P-value / FDR / FC (abs) / Regulation / circRNA / Alias / circRNA_type / chrom / strand / best_transcript / group-T(raw) / group-C(raw) / MRE1 / MRE2 / MRE3 / MRE4 / MRE5
ASCRP004502 / 0.02152532 / 0.27324489 / 2.447928 / up / hsa_circRNA_104230 / hsa_circ_0078346 / exonic / chr6 / - / uc021zhc.1 / 595.666667 / 311.333333 / hsa-miR-92a-2-5p / hsa-miR-103a-2-5p / hsa-miR-412-3p / hsa-miR-802 / hsa-miR-328-5p
ASCRP004887 / 0.00515623 / 0.21622714 / 5.132574 / up / hsa_circRNA_104634 / hsa_circ_0084615 / exonic / chr8 / - / uc003xuo.2 / 327.333333 / 116.666667 / hsa-miR-384 / hsa-miR-670-3p / hsa-miR-548c-3p / hsa-miR-145-3p / hsa-miR-376a-5p
ASCRP004969 / 0.04449332 / 0.29802929 / 3.105561 / up / hsa_circRNA_104718 / hsa_circ_0085803 / exonic / chr8 / - / uc003ywj.3 / 1246.166667 / 469.166667 / hsa-miR-661 / hsa-miR-328-3p / hsa-miR-636 / hsa-miR-493-3p / hsa-miR-1271-3p
ASCRP005260 / 0.04787052 / 0.30057138 / 1.596087 / up / hsa_circRNA_105013 / hsa_circ_0001936 / exonic / chrX / - / uc004edo.3 / 1605.666667 / 1292.833333 / hsa-miR-141-5p / hsa-miR-486-5p / hsa-miR-578 / hsa-miR-135a-5p / hsa-miR-135b-5p
ASCRP001829 / 0.02346683 / 0.27324489 / 2.704713 / up / hsa_circRNA_101478 / hsa_circ_0008946 / exonic / chr15 / + / uc010ucl.1 / 2046.5 / 729.388889 / hsa-miR-374a-3p / hsa-miR-342-5p / hsa-miR-422a / hsa-miR-204-3p / hsa-miR-517c-3p
ASCRP002616 / 0.04027673 / 0.29190714 / 2.427676 / up / hsa_circRNA_102297 / hsa_circ_0009022 / exonic / chr18 / - / uc002kod.1 / 541.833333 / 290.666667 / hsa-miR-519e-5p / hsa-miR-1298-3p / hsa-miR-320a / hsa-miR-320b / hsa-miR-130a-5p
ASCRP002918 / 0.01775696 / 0.273034 / 1.698842 / up / hsa_circRNA_102605 / hsa_circ_0052455 / exonic / chr2 / - / uc002qxd.3 / 1112.722222 / 692.777778 / hsa-miR-486-3p / hsa-miR-1264 / hsa-miR-370-3p / hsa-miR-138-5p / hsa-miR-23a-5p
ASCRP002926 / 0.01779897 / 0.273034 / 2.445091 / up / hsa_circRNA_102613 / hsa_circ_0052523 / exonic / chr2 / + / uc002qzh.2 / 328.222222 / 187.277778 / hsa-miR-485-5p / hsa-miR-423-3p / hsa-miR-670-5p / hsa-miR-125a-5p / hsa-miR-185-3p
ASCRP003063 / 0.02609809 / 0.27582713 / 3.361964 / up / hsa_circRNA_102751 / hsa_circ_0055033 / exonic / chr2 / + / uc002sfd.2 / 4495.444444 / 1451.611111 / hsa-miR-382-3p / hsa-miR-532-5p / hsa-miR-432-3p / hsa-miR-218-2-3p / hsa-miR-623
ASCRP003082 / 0.02299166 / 0.27324489 / 1.908833 / up / hsa_circRNA_102771 / hsa_circ_0055377 / exonic / chr2 / + / uc010yse.2 / 746.222222 / 462.722222 / hsa-miR-492 / hsa-miR-1298-3p / hsa-miR-22-3p / hsa-miR-505-3p / hsa-miR-136-5p
ASCRP003113 / 0.04813859 / 0.3006914 / 1.723587 / up / hsa_circRNA_102804 / hsa_circ_0056139 / exonic / chr2 / + / uc002thu.3 / 824.722222 / 563.222222 / hsa-let-7f-5p / hsa-let-7i-5p / hsa-let-7a-5p / hsa-let-7g-5p / hsa-miR-148a-5p
ASCRP000189 / 0.01694328 / 0.273034 / 2.118822 / up / hsa_circRNA_001059 / hsa_circ_0000554 / intragenic / chr14 / + / NM_001024674 / 13338 / 5099.722222 / hsa-miR-423-5p / hsa-miR-150-3p / hsa-miR-612 / hsa-miR-567 / hsa-miR-558
ASCRP000343 / 0.0015026 / 0.20654019 / 7.826006 / up / hsa_circRNA_001846 / hsa_circ_0000520 / intragenic / chr14 / - / NR_002312 / 18685.05556 / 2612.611111 / hsa-miR-328-3p / hsa-miR-1296-5p / hsa-miR-146b-3p / hsa-miR-330-5p / hsa-miR-608
ASCRP000372 / 0.02725941 / 0.2768338 / 2.369361 / up / hsa_circRNA_002044 / hsa_circ_0000228 / exonic / chr10 / + / ENST00000437844 / 2010.277778 / 926.388889 / hsa-miR-136-5p / hsa-miR-494-5p / hsa-miR-617 / hsa-miR-148a-5p / hsa-miR-410-5p
ASCRP000475 / 0.03976013 / 0.291158 / 2.72342 / up / hsa_circRNA_100085 / hsa_circ_0005075 / exonic / chr1 / - / uc001bee.3 / 1935.944444 / 712.111111 / hsa-miR-23b-5p / hsa-miR-93-3p / hsa-miR-10b-3p / hsa-miR-23a-5p / hsa-miR-581
ASCRP000909 / 0.03068738 / 0.27913166 / 2.230108 / up / hsa_circRNA_100528 / hsa_circ_0017454 / exonic / chr10 / + / uc001igg.1 / 428.055556 / 249.777778 / hsa-miR-511-5p / hsa-miR-489-3p / hsa-miR-892b / hsa-miR-29b-3p / hsa-miR-29c-3p
ASCRP001111 / 0.00838126 / 0.2523525 / 3.562145 / up / hsa_circRNA_100737 / hsa_circ_0008301 / exonic / chr11 / - / uc001ltd.3 / 4389.666667 / 1347.166667 / hsa-miR-661 / hsa-miR-1301-3p / hsa-miR-608 / hsa-miR-138-5p / hsa-miR-874-3p
ASCRP001462 / 0.02217329 / 0.27324489 / 1.567952 / up / hsa_circRNA_101094 / hsa_circ_0027478 / exonic / chr12 / + / uc001suf.3 / 10142.16667 / 4682.277778 / hsa-miR-1301-3p / hsa-miR-582-5p / hsa-miR-215-3p / hsa-miR-26b-3p / hsa-miR-646
ASCRP001697 / 0.04821284 / 0.3006914 / 3.004905 / up / hsa_circRNA_101338 / hsa_circ_0031570 / exonic / chr14 / - / uc001wrf.4 / 663.5 / 241.666667 / hsa-miR-545-3p / hsa-miR-452-5p / hsa-miR-34a-3p / hsa-miR-488-3p / hsa-miR-1323
ASCRP001816 / 0.02486773 / 0.27324489 / 3.522743 / up / hsa_circRNA_101465 / hsa_circ_0034189 / exonic / chr15 / - / uc001zbh.4 / 7561.555556 / 1451.555556 / hsa-miR-26b-3p / hsa-miR-675-5p / hsa-miR-544a / hsa-miR-589-5p / hsa-miR-146a-5p
ASCRP003114 / 0.01549866 / 0.273034 / 1.847977 / up / hsa_circRNA_102805 / hsa_circ_0056146 / exonic / chr2 / + / uc002thw.2 / 865.222222 / 512.5 / hsa-miR-214-3p / hsa-miR-181d-5p / hsa-miR-550a-5p / hsa-miR-432-5p / hsa-miR-500a-5p
ASCRP003232 / 0.00603238 / 0.22227733 / 2.011461 / up / hsa_circRNA_102924 / hsa_circ_0008365 / exonic / chr2 / - / uc002vnu.2 / 460.666667 / 289.611111 / hsa-miR-432-5p / hsa-miR-103a-2-5p / hsa-miR-605-3p / hsa-miR-130a-5p / hsa-miR-765
ASCRP003550 / 0.03631051 / 0.28571085 / 2.702528 / up / hsa_circRNA_103252 / hsa_circ_0008472 / exonic / chr22 / + / uc003bgn.2 / 2046.777778 / 888.833333 / hsa-miR-204-3p / hsa-miR-501-3p / hsa-miR-502-3p / hsa-miR-18b-5p / hsa-miR-640
ASCRP003706 / 0.03023834 / 0.27913166 / 2.497356 / up / hsa_circRNA_103408 / hsa_circ_0066444 / exonic / chr3 / - / uc003dmg.3 / 14590.27778 / 4203.555556 / hsa-miR-372-5p / hsa-miR-770-5p / hsa-miR-451a / hsa-miR-767-3p / hsa-miR-221-5p
ASCRP003849 / 0.03303323 / 0.2823148 / 1.952633 / up / hsa_circRNA_103551 / hsa_circ_0068563 / exonic / chr3 / - / uc011bsw.1 / 410.555556 / 265.777778 / hsa-miR-520d-3p / hsa-miR-520a-3p / hsa-miR-302c-3p / hsa-miR-302a-3p / hsa-miR-302b-3p
ASCRP004278 / 0.04276806 / 0.29571902 / 2.017218 / up / hsa_circRNA_103998 / hsa_circ_0074817 / exonic / chr5 / - / uc011ddw.2 / 11968 / 4025.5 / hsa-miR-21-3p / hsa-miR-651-3p / hsa-miR-27a-3p / hsa-miR-138-1-3p / hsa-miR-539-5p
# Column A: probeID it represents probe name.
# Column B: P-value, P-value calculated from paired t-test.
# Column C: FDR, FDR is calculated from Benjamini Hochberg FDR.
# Column D: FC (abs), the absolute ratio (no log scale) of normalized intensities between two conditions.
# Column E: Regulation, it depicts which group has greater or lower intensity values wrt other group.
# Column L, M: Raw Intensity of each group (averaged raw intensities of replicate samples).
Note:
Alias: the circRNA ID in circBase (
circRNA_type: The circRNAs are classified into 5 types: "exonic", "intronic", "antisense", "intragenic" and "intergenic".
"Exonic" represents circRNA arising from the exons of the linear transcript;
"Intronic" represents the circRNA arising from an intron of the linear transcript;
"antisense" represents circRNA whose gene locus overlap with the linear RNA, but transcribed from the opposite strand;
"intragenic" represents circRNA transcribed from same gene locus as the linear transcript, but not classified into "exonic" and "intronic";