Table 1 General Properties of the Three Cdna Libraries

Table 1 General properties of the three cDNA libraries

Description / Intestine / Mantle / Hepatopancreas / Total
Total number of clones sequenced / 1065 / 1087 / 1087 / 3224
Total number of successful sequences / 1045 / 1069 / 1059 / 3158
Number of high-quality ESTs / 1005 / 1019 / 1005 / 3129
Total number of unigenes / 580 / 570 / 646 / 1796
Number of contigs / 79 / 116 / 111 / 306
Number of singletons / 501 / 454 / 535 / 1490
Matched known ESTs, n (%) / 216(37.2%) / 235(41.2%) / 245(37.9%) / 696(38.8%)
No database match, n (%) / 364(62.8%) / 335(58.5%) / 401(62.1%) / 1100(61.2%)
Average EST size (bp) / 746 / 705 / 750 / 734

Table 2Unigenes related to immune defense from the hard clam Meretrix meretrix

Putative function / GeneBank
Accession no. / Redundancya / E-value / Organism with
the closest match
Immune recognition receptor
lipopolysaccharide- and
beta-1,3-glucan-binding protein / GR902645 / 2 / 2.00E-43 / Chlamys farreri
LPS-binding protein (LBP) and bactericidal/permeability-increasing protein (BPI) / GR211142 / 1 / 7.00E-45 / Crassostrea gigas
C-type lectin A / GT184187 / 10 / 5.00E-22 / Chlamys farreri
sialic acid binding lectin / GR211924 / 1 / 2.00E-22 / Haliotis discus
tandem repeat galectin / GT184249 / 6 / 5.00E-15 / Biomphalaria glabrata
C1q domain-containing protein / GT184243 / 2 / 5.00E-28 / Chlamys farreri
Stress proteins
ferritin subunit / GR902845 / 8 / 1.00E-83 / Meretrix meretrix
metallothionein / GR211166 / 1 / 4.00E-108 / Meretrix lusoria
selenium-binding protein / GR211744 / 6 / 9.00E-99 / Chlamys farreri
heat shock protein 22 / GT184380 / 2 / 7.00E-104 / Venerupisphilippinarum
heat shock protein 70 / GR902650 / 1 / 4.00E-81 / Hymeniacidonperlevis
heat shock protein 90 / GR902583 / 1 / 8.00E-71 / Laternulaelliptica
Cu/Zn superoxide dismutase / GR902740 / 1 / 1.00E-65 / Plutellaxylostella
cyclophilin G / GR902760 / 2 / 5.00E-72 / Tachypleustridentatus
Proteases and Proteases inhibitors
mu class glutathione-S-transferase / GR902774 / 1 / 1.00E-69 / Haliotisdiversicolor
sigma-class glutathione S-transferase / GR902583 / 1 / 1.00E-85 / Laternulaelliptica
microsomal glutathione S-transferase / GR211738 / 2 / 3.00E-24 / Meretrix lusoria
glutathione peroxidase / GR902650 / 2 / 1.00E-104 / Venerupisphilippinarum
cathepsin B / GR211794 / 1 / 1.00E-160 / Meretrix meretrix
cathepsin C / GR211893 / 1 / 2.00E-64 / Fundulus heteroclitus
cathepsin D / GR211702 / 1 / 2.00E-86 / Chlamys farreri
cathepsin L / GR902582 / 5 / 2.00E-49 / Theromyzontessulatum
cathepsin Z / GR211220 / 2 / 2.00E-111 / Mus musculus
serine protease inhibitor 2 / GR902535 / 2 / 2.00E-15 / Crassostreavirginica
Kazal-type serine proteinase inhibitor / GR211585 / 1 / 1.00E-33 / Chlamys farreri
Other immune-related genes
LPS-induced TNF-alpha factor / GR211386 / 10 / 5.00E-35 / Chlamys farreri
Inhibitor of nuclear factor-kappa B / GR902432 / 3 / 3.00E-23 / Crassostrea gigas
interferon regulatory factor 2 / GR211919 / 2 / 1.00E-34 / Danio rerio
macrophage migration inhibitory factor / GR211826 / 2 / 8.00E-31 / Haemaphysalis longicornis
alpha-2-macroglobulin
receptor-associated protein / GR211368 / 1 / 4.00E-18 / Pediculus humanus
leukocyte immune-type receptor / GR902656 / 1 / 1.00E-14 / Monodelphisdomestica

Table 3 Characterization of seven polymorphic microsatellite markers from ESTs of hard clam (Meretrix meretrix)

Locus
(Accession no.) / Repeat motif / Primer (5’-3’) / Tm
(oC) / Na / Size
(bp) / Ho / He
MmMS03
(GR211375) / (TGTAC)5...
(GTGCT)6 / F: ATATCTGCCATATTCGATTGTCA
R: GCACAAATCCTACAAGGTTACAGA / 58 / 8 / 250 / 0.810 / 0.860
MmMS04
(GR211423) / (TGA)8 / F: GATGACTACATTCAACAGTCGTG
R: GCCAAGGTTATAGTATTTATTTCTG / 54 / 3 / 154 / 0.546 / 0.650
MmMS07
(GR211583) / (GA)7 / F: GATGGTAGCCACAACAAGCAC
R: ATTCAACTTCAACCTAGCAAAACAT / 56 / 2 / 169 / 0.308 / 0.434
MmMS09
(GR902856) / (CAG)5 / F: TCAACTGTAAATGGGAGTGTATC
R: GCTGACGACGTAGGGTTAGTA / 53 / 4 / 176 / 0.111 / 0.143
MmMS11
(GR211709) / (TACAA)5 / F: GGATGGGCACAGATTTTGAAG
R: TGTGTTGGCATAAGCCTATACAGAG / 57 / 5 / 184 / 0.471 / 0.619
MmMS12
(GR211801) / (TG)30 / F: GGTGGTAGGCACATAGTGTTAC
R: TGAAATCATGGATGAAGAAGC / 53 / 5 / 154 / 0.333 / 0.610
MmMS20 / (TACT)4 / F: TACCATATACTTTGAATTTACTCAC
R: TTCATTGAAAATAAAATGACG / 51 / 3 / 265 / 0.053 / 0.323

Tm, annealing temperature; Na, number of alleles; Ho, observed heterozygosity; He, unbiased expected heterozygosity.