Shirley Zhu/ cDNA library construction 3/10/2014

mRNA 3’ End Library Construction for samples from FFPE (Formaldehyde Fixed Paraffin-Embedded tissues ) with Illumina HISeq sequencers

Following isolation of total RNA, shearing is recommended if a smear is observed as high as the 28s or 18s bands. If no smear of RNA is appreciated at this size, than the heat shearing step can be skipped.

Denature alone:

-In a 0.2 ml PCR tube, mix:

mRNA (about 1ng-50ng) 9ul

Primer RT_P7dT_Index (10uM) 1ul

Total volume 10ul

Index Bar code (see Page6 for the sequence information):

Index_2

Index_4

Index_6

Index_8

(For Hi-Seq machine, 1 lane includes 4 samples with index bar codes.)

-Mix well; incubate the tube at 85C for 5 min, then cool down to 50C in thermal cyclers.

Denature and Heat shearing of PolyA-selected RNA (mRNA)

-In a 0.2 ml PCR tube, mix:

mRNA (about 1ng-50ng) 9ul

Primer P7_oligodT (10uM) [We order from IDT] 1ul

First strand buffer (Invitrogen CAT#18080-044) 4ul

Total volume 14ul

-Mix well; For high quality RNA (ex. from frozen tissue, cell line), incubate the tube at 85C for 5-10 min, then cool down to 50C in thermal cyclers. For degraded RNA from FFPE, incubate the tube at 85C for 3-5 min, then cool down to 50C in thermal cyclers.

First Strand cDNA Synthesis

-to each 10ul of mRNA, add: (keep the samples at 50C)

[Don’t add first strand buffer if previously added during heat shearing]

First strand buffer (Invitrogen CAT#18080-044) 4ul

0.1M DTT 2ul

10mM total dNTP (2.5mM each dNTP) 1ul

RNaseOUT (Invitrogen CAT#10777-019) 1ul

Superscript III Reverse Transcriptase 2ul

(Invitrogen CAT#18080-044) 10ul

-make total volume to 20ul

-Incubate at 50C for 1 hour, then followed by 85C for 15 min to inactivate enzymes.

Second Strand cDNA synthesis

-to 20ul of 1st strand cDNA synthesis solution, add:

H2O 91ul

5X 2nd strand buffer (Inv. CAT#10812-014) 30ul

10mM dNTP 3ul

E.coli DNA ligase(Inv. CAT#18052-019) 1ul

E.coli DNA polymerase I 4ul

(New England Biolab, CAT# M0209L)

E.coli RNaseH (Epicentre, Cat# R0601K) 1ul

130ul

-make total volume to 150ul

-Incubate at 16C for 2 hours

-add 2ul of T4 DNA Polymerase (New England Biolab, CAT# M0203S)

-Incubate at 16C for 15 min

-add 10ul of 0.5M EDTA pH 8.0 to each tube to stop the 2nd strand synthesis reaction

-the volume now is 162ul

Purify the double stranded DNA with Qiagen MinElute Reaction Cleanup Kit (CAT# 28204)

-add 486ul (3 volumes of 162ul the double stranded DNA) of buffer ERC or PB, mix well

-apply the sample to the columns

-Centrifuge at 14K rpm for 1 min, discard the flow-through

-add 750ul wash buffer PE to the column and centrifuge same as above, repeat once;

-dry the columns by 14K rpm for 3 min,

-transfer the column at a 1.5ml clean tube

-elute with 33.5ul of buffer EB, stand at RT for 1min

-Centrifuge at 14K rpm for 1 min

-Reload once, to get 32ul of dsDNA

Addition of ‘A’ Base to the 3’ end of the DNA Fragments

-Prepare the following reaction mix:

Klenow buffer (NEB buffer 2, B7002S) 5ul

1mM dATP 10ul

Klenow exo (3’ to 5’ exo minus, M0212L) 3ul

18ul

-add to 32ul of DNA sample

-the total volume is 50ul

-incubate the 50ul at 37 C for 30 min.

Purify the DNA with Qiagen MinElute PCR Purification Kit

(CAT# 28204)

(Use 3 volume of PBI buffer)

-Add 150ul of PB or ERC buffer to 50ul of DNA samples

-apply the sample to the columns

-Centrifuge at 14K rpm for 1 min, discard the flow-through

-add 750ul wash buffer PE to the column and centrifuge same as above, repeat once;

-dry the columns by 14K rpm for 3 min,

-transfer the column at a 1.5ml clean tube

-elute with 11.5ul of buffer EB, stand at RT for 1min

-Centrifuge at 14K rpm for 1 min

-Reload once, to get 10ul of DNA fragment

Ligation of Adapters to DNA fragments

-Prepare the following reaction mix on ice:

2XDNA ligase buffer (B2200S) 15ul

Adapter Oligo Mix

(From Illumina, Part# 1001782)

(1:50 dilution) 2ul

DNA ligase (M2200L) 3ul

20ul

-Add to 10ul of DNA

-The total volume is 30ul

-Incubate at 22C for 15 min

Purify the ligated DNA with SPRI beads from Agencourt (Part# A63880)

-Add 20ul of H2O to 30ul of the ligated DNA, total volume should be 50ul.

-Add an equal amount well mixed SPRI beads to the 50ul of ligated DNA. Mix well by pipette up and down for 10 times

-Sit for 5 min at room temperature.

-Place the tube in a magnetic plate and keep for 2 min., discard the supernatant.

-Add 300ul of 70% Ethanol to the tube without disturbing the beads, incubate for 1min at room temperature, and discard the supernatant. Repeat once.

-Air dry the beads for 5-10 min.; be sure to remove all of the ethanol.

-Off the magnetic rack.

-Add 30ul of EB buffer to the beads.

-Pipette mixing the beads for 10 times

-Sit at room temperature for 2 min.

-Place the tube to the magnetic rack and keep for 2 min.

-Transfer the 40ul of supernatant to a new 1.5ml tube. (LoBind tube, Eppendorf, Cat# 022431021)

PCR amplification of Adapter ligated DNA

-Prepare 100ul PCR reaction mix on ice:

2X phusion PCR master mix (NEB M-0531S) 50ul

PCR primer_F (from IDT),10uM/ul 5ul

PCR primer_R_index (from IDT) 10uM/ul 5ul

Total 60ul

PCR primer Index Bar codes have to match the Primer RT_P7dT_Index:

PCR_Index_2 to P7dT_Index_2

PCR_Index_4 to P7dT_Index_4

PCR_Index_6 to P7dT_Index_6

PCR_Index_8 to P7dT_Index_8

-Add to 40ul of adapter-ligated DNA,

-total volume is 100ul

(Always has a negative control with H2O for PCR reaction)

-Amplify with 15-cycle PCR with following conditions:

98C/30sec

15 cycles of (98C/10sec, 65C/30sec, 72C/30sec)

72C/5min

10C/hold

Purify the ligated DNA with SPRI beads from Agencourt (Part# A63880)

-Add an equal amount (100ul) well mixed SPRI beads to the 100ul of PCR products of cDNA libraries. Mix well by pipette up and down for 10 times

-Sit for 5 min at room temperature.

-Place the tube in a magnetic plate and keep for 2 min., discard the supernatant.

-Add 300ul of 70% Ethanol to the tube without disturbing the beads, incubate for 1min at room temperature, and discard the supernatant. Repeat once.

-Air dry the beads for 5-10 min. be sure to remove all of the ethanol.

-Off the magnetic rack.

-Add 30ul of EB buffer to the beads.

-Pipette mixing the beads for 10 times

-Sit at room temperature for 2 min.

-Place the tube to the magnetic rack and keep for 2 min.

-Transfer the supernatant to a new 1.5ml tube. (LoBind tube, Eppendorf, Cat# 022431021)

Gel purification and size selection of ligation products

-Run the library PCR products on 3% Nusieve GTG agarose gel.

-Prepare 3% Nusieve GTG agarose gel:

-3g of GTG agarose in 100ml of 1X TBE buffer,

-stir 15min at room temperature

-Heat at a hot plate with stirring; cover the beaker.

-bring the solution to a boil while stirring

-Maintain gentle boiling until all the agarose are dissolved; about 10-15min

-cool the solution to 50-60C prior to casting

-50ml for a double tray, 25ml for a single tray

**Using Submarine-type electrophoresis system, Mupid-2plus (Helixx Technologies, Inc)

-Casting gels for at least 40 min.

-Running condition: full voltage (100v), running time about 1.5 hour

-running buffer: 0.5X TBE, about 400ml for one unit.

-Excise the band in the 200-300 bp; using 25bp DNA ladder (Invitrogen, Cat# 10488-022)

-Purify the 200-300bp band using QIAquick Gel extraction kit, (Qiagen, CAT# 28704).

-Weigh the gel slice in a 15ml conical tube

-Add 6 volume buffer QG (eg. 600ul QG to 100mg gel)

-Allow the gel completely dissolve at room temperature, about 15-30min.

-Add one volume (eg. 100ul for 100mg gel) of Isopropanol to the sample and mix well by inverting the tube.

-Apply the sample (750ul) to the column and centrifuge at 14K rpm for 1 min, discard the flow-through.

-Repeat as many times as necessary until all solution loaded.

-Add 500ul QG to the column and centrifuge at 14k rpm for 1min to remove residual agarose. Discard the flow-through

-Add 750ul wash buffer PE to the column and centrifuge at 14K rpm for 1 min. Repeat once.

-Centrifuge the column at 14k for 3min. to remove residual wash buffer;

-Transfer the column to a clean 1.5ml tube, add 32ul buffer EB to the column to elute the DNA, stand at RT for 1min.

-Centrifuge the column at 14K rpm for 1 min.

-Reload once; get 30ul of purified amplified adapter-ligated DNA

-Qubit (Qubit® 2.0 Fluorometer , Life Technologies) for OD measurement.

Pooling 4 samples for Illumina HI-Seq:

Each sample has to be exact amount:

Sample1 with Index_2 30-100ng

Sample2 with Index_4 30-100ng

Sample3 with Index_6 30-100ng

Sample4 with Index_8 30-100ng

(A minimum of 30 ng per sample)

-give a new name for the pooling sample.

-Qubit again to get the concentration.

-Ready for the deep Sequencing with Illumina HI-Seq

Index Bar code sequence for submission:

Index_2: CGATGT

Index_4: TGACCA

Index_6: GCCAAT

Index_8: ACTTGA

Oligonucleotides ordered from IDT:

RT Primers (RNase-free HPLC purify)

RT_P7dT_Index 2

5’ CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTTTT*V*N 3’

RT_P7dT_Index 4

5’ CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTTTT*V*N 3’

RT_P7dT_Index 6

5’ CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTTTT*V*N 3’

RT_P7dT_Index 8

5’ CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTTTT*V*N 3’

PCR Primers (HPLC purify)

PCR_F

5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 3’

PCR_R _Index 2

5’ CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTC 3’

PCR_R _Index 4

5’ CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTC 3’

PCR_R _Index 6

5’ CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTC 3’

PCR_R _Index 8

5’ CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTC 3’

- 1 -