Preparing samples and running PCR ALU Lab
Teacher’s Guide:December, 2015
PCR is a very sensitive process. The DNA samples can be easily contaminated. Please wear gloves and perform all work carefully and as sterilely as possible!
Equipment and Supplies:Master Mix Reagents:
Thermal cyclerdNTP's (50mM)
Microfuge tubesForward primer (4pm/uL)
Permanent markerReverse primer (4pm/uL)
Sterile toothpicks10X PCR buffer w/o MgCl2
VortexerTaq Polymerase
Ice bucket/IceMagnesium Chloride (MgCl2)
PCR tubes Molecular grade PCR water
Remove reagents and DNA samples from the freezer and allow them to thaw on ice. Leave Taq Polymerase in freezer until ready to use. Mix/Finger vortex all reagents just prior to use.
Note: Change pipette tips after each use!
Prepare Master Mix(use table on next page for calculating the total volume of master mix needed) in a clean sterilemicrofuge tube using volumes calculated for total number of samples you're planning to run. Keep all reagents and Master Mix on ice. Don't forget to add Taq Polymerase which is still in the freezer!
Add 20µL of Master Mix to each DNA sample for a total volume of 25uL (5uL DNA sample + 20uL of Master Mix). Keep on ice.
Take samples to the PCR machine and Run program “Amgen PCR”. (2 ½ to 3 hours)
The last step of the PCR run will hold at 4 degrees Celsius for infinity so you do not have to be present when the run is complete.
After the PCR run, place the samples in the freezer until the students are ready to run their gels.
Next class period prepare gels, run samples, and take photos.
Master Mix for PCR Program for Amplifying the ALU element
PCR is a very sensitive process. The samples can be easily contaminated. Please wear gloves and perform all work carefully and as sterilely as possible!
Vortex all reagents just prior to use and vortex the MM once all reagents are combined
Change pipette tips after each use!!!
Master Mix (MM) for 1 PCR Sample: / Amount(s) needed for ___ samplesMolecular grade water 11.1 µl
Forward primer Alu 1_tPA(4pM/uL) 2.5 µl
Sequence: 5' GTAGAGTTCCGTAACAGGACAGCT 3'
Reverse primer Alu2_tPA(4pM/uL) 2.5 µl
Sequence: 5' CCCCACCCTAGGAGAACTTCTCTTT 3'
dNTP mix, (10mM) 0.5 µl
10x PCR buffer W/O Magnesium 2.5 µl
50 mM Magnesium Chloride 0.75 µl
Taq polymerase 500 units (5 U/µl) .15 µl
Total Master Mix volume = 20µl / Total MM volume:
*** To process several samples, multiply the amount of each reagent above by the
total number of samples:
Total number of samples= # of DNA samples + H2O Ctrl(s) + 2 extra
Total sample volume in each PCR tube: 25 µl = 20 µl Master Mix + 5 µl Genomic DNA