Table 1PCR sense (S) and antisence (A) primers, size of PCR product and annealing temperature for the Src gene

Loci / Primer sequences 5’→3’ / Size of PCR product (bp) / Annealing temperature (°)
g.14062CT / S:GAGAATGCTTGCCCTACACG / 823 / 63.6
A:ATCCAGGGAGGAGCGAGAG
g.17302GA / S1:TACAGTCCCAAACCCATAC / 852 / 56.9
A1:ATAGCCATCCTACCTCCTC / 252 / 56.8
S:ACCCTCACTGATCTCATCA*TAT
A2:TAGCCATCCTACCTCCTCT
g.18107TC / S1:GCTTATGTGGAACGGATGAAC / 294 / 56.0
A1:TGTAGGAACAAGAACGGTCG
210 / 56.2
S2:GCTTATGTGGAACGGATGAAC
A2:GAAGAAACTGAGGCCCTGA*G

Notes: The asterisk indicates creation of a restriction site in the primer sequences, base A with underline of primer g.17302GA S2 indicates base C is replaced by base A, base C and T with underline of primer g.18107TC A2 indicates fourth base A and sixth base T of 3’ end is replaced respectively by base T and base C

Table 2Fragment size corresponding to different Src gene genotypes after digestion of PCR products with different restriction enzymes

locus / Enzyme / Genotypes/Sizes of fragment (bp)
g.14062CT / MspⅠ / CC 78+247+498
TT 78+745
CT 78+247+498+745
g.17302GA / NdeⅠ / GG 19+233
AA 252
GA 19+233+252
g.18107TC / SauⅠ / TT 210
CC 192+19
TC 192+210+19

Table 3Genotypic and allelic frequencies and Hardy-Weinberg Equilibrium χ2 test of Src gene at position g.14062CT (a), g.17302GA (b) andg.18107TC (c)

(a)
Breeds / Observed Genotype / Allelic frequency / Hardy-Weinberg Equilibrium
CC / TC / TT / N / C / T / χ2 test
Chinese Holsteins / 367 / 351 / 91 / 809 / 0.6706 / 0.3294 / Equilibrium(P0.05)
0.4536 / 0.4339 / 0.1125
Luxi yellow cattle / 54 / 68 / 14 / 136 / 0.6471 / 0.3529 / Equilibrium(P0.05)
0.3971 / 0.5 / 0.1029
Bohai black cattle / 9 / 20 / 11 / 40 / 0.475 / 0.525 / Equilibrium(P0.05)
0.225 / 0.5 / 0.275
(b)
Breeds / Observed Genotype / Allelic frequency / Hardy-Weinberg Equilibrium
AA / GA / GG / N / A / G / χ2 test
Chinese Holsteins / 186 / 303 / 320 / 809 / 0.4172 / 0.5828 / Disequilibrium（p0.05）
0.2299 / 0.3745 / 0.3956
Luxi yellow cattle / 44 / 10 / 82 / 136 / 0.3603 / 0.6397 / Disequilibrium（p0.05）
0.3235 / 0.0735 / 0.6030
Bohai black cattle / 2 / 3 / 35 / 40 / 0.0875 / 0.9125 / Disequilibrium（p0.05）
0.05 / 0.075 / 0.875
(c)
Breeds / Observed Genotype / Allelic frequency / Hardy-Weinberg Equilibrium
TT / TC / CC / N / T / C / χ2 test
Chinese Holsteins / 148 / 419 / 242 / 809 / 0.4419 / 0.5581 / Equilibrium（P0.05）
0.1830 / 0.5179 / 0.2991
Luxi yellow cattle / 24 / 67 / 45 / 136 / 0.4228 / 0.5772 / Equilibrium（P0.05）
0.1765 / 0.4926 / 0.3309
Bohai black cattle / 7 / 5 / 28 / 40 / 0.2375 / 0.7625 / Disequilibrium（p0.05）
0.175 / 0.125 / 0.7

Table 6Least squares mean (LSM) and standard error (SE) for 305d milk yield, fat and protein rates of different Src haplotype combinations in Chinese Holsteins

Haplotypes combination /Samples / Fat rate (%) / Protein rate (%) / 305 d milk yield (kg) / Fat protein ratio
H1H1(CCAACC)/18 / 3.3343±0.1904 / 3.0494±0.1669 / 6435.3261±609.8560 / 1.0990±0.0956
H1H2(CCAATC) /43 / 3.4731±0.1378 / 3.0749±0.1208 / 5730.2198±454.4333ab / 1.0372±0.0717aBC
H1H3(CCGACC)/23 / 3.4060±0.1751 / 2.9820±0.1535 / 6130.3244±573.1706 / 1.0860±0.1012
H1H4(CCGATC)/86 / 3.4476±0.1146 / 3.0372±0.1004 / 6088.9962±377.2894 / 1.1363±0.0573
H1H6(TCAATC)/16 / 3.5634±0.2016 / 2.8487±0.1768ab / 6923.4879±648.0464 / 1.2487±0.1052
H1H7(TCGACC)/33 / 3.3805±0.1526 / 2.9099±0.1338cd / 6474.1304±498.8191 / 1.1383±0.0816
H1H8(TCGATC)/119 / 3.6484±0.1038a / 3.0450±0.0910 / 6684.9284±344.3582a / 1.2088±0.0549aA
H2H2(CCAATT)/84 / 3.5761±0.1169 / 3.1150±0.1024 / 6519.4235±386.7755 / 1.0444±0.0659ADE
H2H4(CCGATT)/20 / 3.7581±0.1850b / 3.2791±0.1622acef / 6386.1794±621.1899 / 1.0503±0.0984b
H3H3(CCGGCC)/29 / 3.5867±0.1555 / 3.0773±0.1363 / 6735.3674±502.5648 / 1.1570±0.0826
H3H4(CCGGTC)/48 / 3.6912±0.1363c / 3.2271±0.1195bdgh / 6511.8219±444.9856 / 1.1706±0.0683
H3H7(TCGGCC)/81 / 3.4928±0.1172 / 3.0606±0.1028 / 6671.9134±387.0707b / 1.1077±0.0610cd
H3H8(TCGGTC)/71 / 3.5131±0.1193 / 3.0010±0.1046 / 6512.8574±390.4671 / 1.2351±0.0614cBD
H4H4(CCGGTT)/16 / 3.6721±0.2028 / 3.1601±0.1778 / 6553.0749±689.5940 / 1.0821±0.1161
H7H7(TTGGCC)/39 / 3.3477±0.1396abc / 2.9201±0.1224eg / 6617.8549±465.1278 / 1.1368±0.0688
H7H8(TTGGTC)/26 / 3.4804±0.1666 / 2.8883±0.1461fh / 5932.9910±537.6689 / 1.2776±0.0753bdCE

Note: Means with the same small letters within the same row differ at P＜0.05; means with the same capital letters within the same row differ at P＜0.01 and means marked with different superscript or without any superscript do not differ statistically