Phylogeny and Genetic Diversity of Native Rhizobia Nodulating Common Bean

Supplementary Material

Journal name: Applied Microbiology and Biotechnology

Diversity of sporadic symbionts and non-symbiotic endophytic bacteria isolated from nodules of woody, shrub and food legumes in Ethiopia

Aregu Amsalu Aserse1, Leena.A.Räsänen1,2, Fassil Aseffa3 , Asfaw Hailemariam4,5, and Kristina Lindström1,6

1University of Helsinki, Department of Food and Environmental Sciences, Helsinki, Finland, P.O. Box 56, FIN-00014

2Institute of Soil Science and Plant Cultivation, ul. Czartoryskich 8, 24-100 Pulawy, Poland

3Addis Ababa University, Cellular, Microbial and Molecular Biology Program Unit, Addis Ababa, Ethiopia, P.O. Box 1176

4Ministry of Agriculture and Rural Development, National Soil Testing Centre, Addis Ababa, Ethiopia, P.O. Box 147

5Menagesha Biotech Industry P L C, Addis Ababa, Ethiopia. Tel: +251 911411318

6University of Helsinki, Department of Environmental Sciences, Helsinki, Finland, P.O. Box 65, FIN-00014

Corresponding author. Aregu Amsalu Aserse, email address: , Tel: +358191 59278

University of Helsinki, Department of Food and Environmental Sciences, Helsinki, Finland, P.O. Box 56, FIN-00014

Supplementary Table S1. Geographic origin of the bacterial isolates obtained from Crotalariaspp., Erythrina brucei, Indigoferaspp., Phaseolus vulgaris and Glycine max growing in Ethiopia, and soil properties and environmental parameters of the collection sites. Mean annual rainfall and temperature for each site were estimated from ten years average data provided by GIS division of Ethiopian institute of agricultural research and the national meteorology agency of Ethiopia.

Isolates / Host plant / District / Site / Latitude / Longitude / Altitude (m) / Rainfall (mm) / Average Temp (OC) / Soil pH
HBR6 / P. vulgaris / Konso/ Karat / Tishale / N05 o 19’ 9.60’’ / E037 o 25’ 43.09’’ / 1504.0 / 638.0 / 24.3 / 6.96
HBR8 / P. vulgaris / Arbaminch / Pura / N06 o 11’ 18.91’’ / E037 o 42’ 39.32’’ / 2057.0 / 1097.0 / 17.7 / 6.7
HBR15 / P. vulgaris / Adama/Naziret / Adama / N08 o 32’ 3.99’’ / E039 o 14’ 20.05’’ / 1661.0 / 756.0 / 19.5 / 7.01
HBR16A, HBR16B / P. vulgaris / Adama/Naziret / Adama / N08 o 32’ 19.91’’ / E039 o 15’ 42.52’’ / 1661.0 / 756.0 / 19.5 / 6.9
HBR25 / P. vulgaris / Bost / Kelechacule / N08 o 40’ 8.96’’ / E039 o 26’ 33.81’’ / 1661.0 / 756.0 / 19.5 / 7.2
HBR27 / P. vulgaris / Adama / Debisa / N08 o 37’ 17.16’’ / E039 o 24’ 41.48’’ / 1661.0 / 756.0 / 19.5 / 6.91
HBR28 / P. vulgaris / Mendida / Kersa / n.d / n.d / n.d / n.d / n.d / n.d
HBR30 / P. vulgaris / Pawe / Pawe / 36.05 / 11.15 / 1279.0 / 1029.0 / 19.0 / 6.2
HBR37 / P. vulgaris / Chiro / Alberekti / N09 o 3’ 16.74’’ / E040o 53’ 38.75’’ / 1599.0 / 746.0 / 19.5 / 7
HBR38 / P. vulgaris / Chiro / Alberekti / N09 o 3’ 21.34’’ / E040o 55’ 5.05’’ / 1599.0 / 746.0 / 19.5 / 7.3
HBR44 / P. vulgaris / Chefe / Ourgi Dimtu / N09 o 10’ 16.63’’ / E041o 5’ 21.46’’ / 1599.0 / 746.0 / 19.5 / 7.43
HBR48 / P. vulgaris / Tulo / Ouda Nega / N09 o 14’ 28.16’’ / E041o 7’ 19.70’’ / 1599.0 / 746.0 / 19.5 / 7.24
HBR58 / P. vulgaris / Alemaya / Tineka / N09 o 23’ 47.63’’ / E042o 0’ 12.07’’ / 1290.0 / 623.0 / 22.7 / 6.52
HBR61 / P. vulgaris / Eide Teyara / Sibelu / N09 o 27’ 50.87’’ / E041o 56’ 46.56’’ / 1290.0 / 623.0 / 22.7 / 7.04
CIR2 / C. incana / Jimma / Bulbu bridge / N07o 39’ 48.56’’ / E036o 52’ 51.96’’ / 2053.0 / 1075.0 / 21.6 / 7.13
CPSR4A, CPSR4B / Crotalariasp. / Lume / Kolba / N08o35'21.9'' / E039o08'21.36'' / 1661.0 / 756.0 / 19.5 / 7.31
CIR5 / C. incana / Sokoru / Enkule / N07o 55’ 56.44’’ / E037o 25’ 28.35’’ / 2053.0 / 1075.0 / 21.6 / 6.95
CIR9A, CIR9B / C. incana / Angacha / Denkorcha / N07o18'21.96'' / E037o57' 49.56'' / 1662.0 / 957.0 / 19.5 / 7.01
CIR11A, CIR11Bs, CIR11Bg / C. incana / Angacha / Denkorcha / N07o18'27.42'' / E037o57' 45.96'' / 1662.0 / 957.0 / 19.5 / 7.01
CIR13 / C. incana / Doyogena / Wongela / N07o26'59.64'' / E037o50' 52.26'' / 1662.0 / 957.0 / 19.5 / 6.99
CIR16B / C. incana / Welkite / Woynbet / N08o16'21.84'' / E037o45' 40.62'' / 1808.0 / 764.0 / 20.1 / 7.36
CIR17B , CIR17C / C. incana / Welkite / kolakebada / N08o16'27.24'' / E037o47' 40.26'' / 1808.0 / 764.0 / 20.1 / 6.67
CIR37C / C. incana / Alemaya / Tineka / N09o 23’ 47.63’’ / E042o 0’ 12.07’’ / 1290.0 / 623.0 / 22.7 / 6.52
CSR2 / C. spinosa / Giga / Giga / n.d / n.d / n.d / n.d / n.d / 7.37
CSR3A / C. spinosa / Lume / Kolba / N08o35' 20.7'' / E039o 08' 27.60'' / 1661.0 / 756.0 / 19.5 / 8.4
CSR5 / C. spinosa / Arsinegele / Kuyeraelala / N07o17' 17.46'' / E038o 39' 1.56'' / 2641.0 / 1169.0 / 12.1 / 7.33
CSR6 / C. spinosa / Alaba / Gubasherero / N07o17' 16.92'' / E038o 12' 13.92'' / 1662.0 / 957.0 / 19.5 / 7.01
CSR7 / C. spinosa / Alaba / Oedeba / N07o18' 37.86'' / E038o 06' 21.48'' / 1662.0 / 957.0 / 19.5 / 7.35
CSR8A, CSR8B / C. spinosa / Alaba / Arsho / N07o18' 37.86'' / E038o 01' 2.22'' / 1662.0 / 957.0 / 19.5 / 8.15
CSR19 / C. spinosa / Abeshegie / tawla / N08o16'48.6'' / E037o41' 36.54'' / 1808.0 / 764.0 / 20.1 / 7.0
IAM11B / I.amorphoides / Addis Alem / Nagadena Sororo / N09o2'15.9'' / E038o22' 42.2'' / 2327.0 / 1236.0 / 14.8 / 6.9
IAR13, IAR14 / I. arrecta / Damot Galie / Delbo Wogenie / N06o 52'2.3'' / E037o48' 39.8'' / 1662.0 / 957.0 / 19.5 / 5.9
IAR21C, IAR22 / I. arrecta / Damot Galie / Delbo Wogenie / N06o 3'34.8'' / E037o48' 10.5'' / 2057.0 / 1097.0 / 17.7 / 5.9
IAR30 / I. arrecta / Chero / Chero / N9 o 6’ 17.09’’ / E40o 57’ 38.24’’ / 1599 / 746 / 19.5 / 7.01
ERR3 / E. brucei / Addis Ababa / National soil center (NSTC) / N09o00'26.1'' / E038o46' 02.4'' / 1661.0 / 756.0 / 19.5 / 7.52
ERR5, ERR6, ERR7 / E. brucei / Addis Ababa / NSTC / N09o00'27.3'' / E038o46' 03.3'' / 1661.0 / 756.0 / 19.5 / 7.45
ERR8 / E. brucei / Harar / Harar / N08o46'55.0'' / E040o29'09.5'' / 1417.0 / 912.0 / 21.9 / 7.13
ERR12 / E. brucei / Abeshegie / Alawla / N08o18'37.54'' / E037o37'46.14'' / 1808.0 / 764.0 / 20.1 / 7.9
ERR15 / E. brucei / Addis Ababa / NSTC / N09o00'26.1'' / E038o46' 02.4'' / 1661.0 / 756.0 / 19.5 / 7.5
ERR16, ERR17 / E. brucei / Harar / Harar / N08o46'55.0'' / E040o29'09.5'' / 1417.0 / 912.0 / 21.9 / 7.13
ERR18 / E. brucei / Addis Ababa / Arat killocampas / N9°1'59" / E38°45'46" / 2327.0 / 1236.0 / 14.8 / 7.5
SBR1A / G. max / Harar / Harar / N08o42'55.5'' / E040o27'0922.4'' / 1417.0 / 912.0 / 21.9 / 6.96
SBR2A / G. max / Pawe / Pawe / 36.05 / 11.15 / 1700.0 / 1441.0 / 21.3 / 6.2
SBR4 / G. max / Pawe / Pawe / 36.05 / 11.15 / 1700.0 / 1441.0 / 21.3 / 5.61

T-average = average temperature of the year, m = meter, mm = millimeter, (OC) = degrees Celsius, n.d= not done

Abbreviations: C, Crotalaria; E, Erythrina; I, Indigofera; G., Glycine; P, Phaseolus.

Supplementary Table S2. Primers used and PCR cycling condition

Primer and their
target gene position * / Sequence 5'-3' / Reference / PCR cycling
fD1 (8-27)
rD1 (1541-1525) / AGA GTT TGA TCC TGG CTC AG
AAG GAG GTG ATC CAG CC / Weisburg et al. (1991) / 2.35’94ºC, 36x(0.5’94ºC, 1’57 ºC,
0.2 ºC /s to 72 ºC, 4’72ºC), 10`72 ºC
recA-6F (1 6-31)
recA-555R (555-530) / CGK CTS GTA GAG GAY AAA TCG GTG GA
CGR ATC TGG TTG ATG AAG ATC ACC AT / Gaunt et al. (2001) / 3’98ºC, 32x(0.3’98ºC, 1’60 ºC, 1’74ºC), 5`72 ºC
glnII-12Fa
glnII-689Ra
GSII-1(69–88)
GSII-4(981–962) / YAA GCT CGA CTA CAT YTC
TGC-ATG-CCS-GAG-CCG-TTC-CA
AAC CGA GAT CAA GGA ATT CG
GCGAACGATCTGGTAGGGGT / Vinuesa et al. (2005)
Turner and Young (2000) / 1’98ºC, 3x(0.15’98ºC,0.30’68 ºC, 0.30’72ºC), 30x(0.15’98ºC,0.30’68 ºC, 0.30’72ºC ),5’72 ºC
1’98ºC, 35 or 36x(0.15’98ºC, 0.30’55or 60 ºC, 0.30’72ºC), 5`72 ºC
rpoB-83F (83-103)
rpoB-1061R (1081-1061) / CCT SAT CGA GGT TCA CAG AAG GC
AGC GTG TTG CGG ATA TAG GCG / Martens et al. (2008) / 3’98ºC, 3x(2’98ºC,2’68 ºC, 1’72ºC),
30x(0.30’98 ºC,1’68 ºC,1’72 ºC )5’72 ºC
nodCfor540 (544–566)
nodCrev1160 (1164–1184) / TGA TYG AYA TGG ART AYT GGC T
CGY GAC ARC CAR TCG CTR TTG / Sarita et al. (2005) / 2’98ºC, 34x(0.15’98ºC, 20 or 30’63 or 65 ºC, 0.20’72ºC), 5`72 ºC
nifH-1F (367-389)
nifH-1R (794-774) / GTC TCC TAT GAC GTG CTC GG
GCT TCC ATG GTG ATC GGG GT / Rivas eta al. (2002) / 1’98ºC, 34x(0.15’98ºC, 0.30’62 ºC, 0.30’72ºC), 5`72 ºC

*Primer position relative to the full gene sequences of the complete genome of S. meliloti 1021

aPrimer coordinates correspond to the binding sites on the genome sequence of B. japonicum USDA110

Supplementary Table S3. Accession numbers of the gene sequences of the test strains.

Strain / 16S rRNA gene / recA / glnII / rpoB / nifH / nodC
CIR2 / KF053318 / n.d / n.d / n.d / n.d / n.d
CPSR4B / KF053319 / KF053270 / KF053283 / KF053296 / KF053308 / -
CIR5 / KF053320 / KF053271 / KF053284 / KF053297 / KF053309 / -
CIR13 / KF053321 / n.d / n.d / n.d / n.d / n.d
CIR16B / KF053322 / KF053273 / KF053286 / KF053299 / KF053311 / -
CSR2 / KF053323 / n.d / n.d / n.d / n.d / n.d
CSR3A / KF053324 / KF053269 / KF053282 / KF053295 / -
CSR8B / KF053325 / KF053272 / KF053285 / KF053298 / KF053310 / -
IAR30 / KF053326 / KF053274 / KF053287 / KF053300 / - / -
ERR6 / KF053327 / KF053275 / KF053288 / KF053301 / - / -
ERR7 / KF053328 / KF053276 / KF053289 / KF053302 / KF053312 / -
ERR8 / KF053329 / KF053277 / KF053290 / KF053303 / KF053313 / -
ERR15 / KF053330 / KF053278 / KF053291 / KF053304 / - / -
ERR16 / KF053331 / KF053279 / KF053292 / KF053305 / KF053314 / KF053316
ERR17 / KF053332 / KF053280 / KF053293 / KF053306 / KF053315 / KF053317
ERR18 / KF053333 / KF053281 / KF053294 / KF053307 / - / -
HBR6 / KF053334 / n.d / n.d / n.d / n.d / n.d
HBR8 / KF053335 / n.d / n.d / n.d / n.d / n.d
HBR15 / KF053336 / n.d / n.d / n.d / n.d / n.d
HBR25 / KF053337 / n.d / n.d / n.d / n.d / n.d
HBR27 / KF053338 / n.d / n.d / n.d / n.d / n.d
HBR28 / KF053339 / n.d / n.d / n.d / n.d / n.d
HBR30 / KF053340 / n.d / n.d / n.d / n.d / n.d
HBR37 / KF053341 / n.d / n.d / n.d / n.d / n.d
HBR38 / KF053342 / n.d / n.d / n.d / n.d / n.d
HBR44 / KF053343 / n.d / n.d / n.d / n.d / n.d
HBR48 / KF053343 / n.d / n.d / n.d / n.d / n.d
HBR16A / KF053345 / n.d / n.d / n.d / n.d / n.d
HBR16B / KF053346 / n.d / n.d / n.d / n.d / n.d
HBR58 / KF053347 / n.d / n.d / n.d / n.d / n.d
HBR61 / KF053348 / n.d / n.d / n.d / n.d / n.d
CPSR4A / KF053349 / n.d / n.d / n.d / n.d / n.d
CIR9A / KF053350 / n.d / n.d / n.d / n.d / n.d
CIR9B / KF053351 / n.d / n.d / n.d / n.d / n.d
CIR11A / KF053352 / n.d / n.d / n.d / n.d / n.d
CIR11Bg / KF053353 / n.d / n.d / n.d / n.d / n.d
CIR11Bs / KF053354 / n.d / n.d / n.d / n.d / n.d
CIR17B / KF053355 / n.d / n.d / n.d / n.d / n.d
CIR17C / KF053356 / n.d / n.d / n.d / n.d / n.d
CIR37C / KF053357 / n.d / n.d / n.d / n.d / n.d
CSR5 / KF053358 / n.d / n.d / n.d / n.d / n.d
CSR6 / KF053359 / n.d / n.d / n.d / n.d / n.d
CSR7 / KF053360 / n.d / n.d / n.d / n.d / n.d
CSR8A / KF053361 / n.d / n.d / n.d / n.d / n.d
CSR19 / KF053362 / n.d / n.d / n.d / n.d / n.d
IAM11B / KF053363 / n.d / n.d / n.d / n.d / n.d
IAR13 / KF053364 / n.d / n.d / n.d / n.d / n.d
IAR14 / KF053365 / n.d / n.d / n.d / n.d / n.d
IAR21C / KF053366 / n.d / n.d / n.d / n.d / n.d
IAR22 / KF053367 / n.d / n.d / n.d / n.d / n.d
ERR3 / KF053368 / n.d / n.d / n.d / n.d / n.d
ERR5 / KF053369 / n.d / n.d / n.d / n.d / n.d
SBR1A / KF053370 / n.d / n.d / n.d / n.d / n.d
SBR2A / KF053371 / n.d / n.d / n.d / n.d / n.d
SBR4 / KF053372 / n.d / n.d / n.d / n.d / n.d

-, no PCR product produced; n.d, not done

Supplementary Table S4. Accession numbers of the sequences of the reference strains used for concatenated analysis in Fig. 2.

Organism / 16S rRNA gene / recA / glnII / rpoB
Rhizobium sp. HBR42 / JN580613 / JN580644 / JN580705 / JN580741
R. leguminosarum WSM2304 / CP001191 / CP001191 / CP001191 / CP001191
R. leguminosarum 3841 / AM236080 / AM236080 / AM236080 / AM236080
R. leguminosarum USDA 2370T / AM181757 / AJ294376 / AF169586 / AM295352
R. etli CFN 42T / CP000133 / CP000133 / CP000133 / CP000133
R. phaseoli ATCC 14482T / EF141340 / EF113136 / JN580716 / FJ392879Top of Form
Bottom of Form
R. phaseoli HBR18 / JN580603 / JN580635 / JN580696 / JN580732
R. lusitanum P1-7T / AY738130 / DQ431674 / EF639841 / FJ816277
R. rhizogenes IAM 13570T / D12788 / AM182126 / FJ816281 / FJ816278
R. rhizogenes K84 / CP000628 / CP000628 / CP000628 / NC 011985
R. tropici CIAT 899T / EU488752 / AJ294373 / CP004015 / AM295354
R. hainanense CCBAU 57015T / U71078 / FJ970375 / GU726294 / JN580753
R. miluonense CCBAU 41251T / EF061096 / HM047131 / HM047120 / JN580752
R. multihospitium CCBAU 83401T / EF035074 / EF490029 / EF490040 / JN580754
R. leucaenae CFN 299T / EU488741 / EU488817 / JF318180 / JN580756
A. fabrum C58T / AE007869 / AE007869 / AE007869 / AE007869
A. tumefaceins HBR75 / JN580619 / JN580652 / JN580712 / JN580749
A. radiobacter HBR78 / JN580621 / JN580653 / JN580713 / N580750
A. radiobacter NCPPB 2437 / AB247617 / AJ294377 / JN580714 / JN580757
A. radiobacter LMG140T / AJ389904 / AM182121 / JN580718 / AM295393
A. radiobacter HBR45 / JN580614 / JN580650 / JN580710 / JN580747
M. caraganae CCBAU 11299T / EF149003 / EU249394 / EU249384 / FJ393287
M. septentrionale HAMBI 2582T / AF508207 / DQ444304 / EU249387 / GQ847884
M. mediterraneum USDA 3392T / L38825 / AM182157 / AF169578 / FJ393284
M. gobiense CCBAU 83330 / EF035064 / EF549481 / EF549451 / FJ393289
B. japonicum LMG 6138T / AB231927 / AM168341 / AY599119 / AM295349
B. canariense LMG 22265T / AJ558025 / AY591553 / AY386765 / FM253263
B. denitrificans LMG 8443T / X66025 / EU665419 / HM047121 / FM253282

Abbreviations:A, Agrobacterium; B, Bradyrhizobium; M, Mesorhizobium; R, Rhizobium.

recA

Fig. S1

glnII

Fig. S2

rpoB

Fig. S3

Supplementary Fig. S1, S2 and S3Maximum likelihoodindividual gene trees based on recA (S1), glnII (S2) rpoB (S3)showing the relationships of new Ethiopian Rhizobium, Mesorhizobium and Agrobacterium strains (bold) isolated from Crotalaria spp., Indigofera arrecta, and Erythrina bruceiand reference strains.Numbers at nodes indicate levels of bootstrap support (using 100 replicates). Scale bars indicate the number of substitutions per site of the genes. The test strains are indicated in bold and type strains are labeled with superscript T. Abbreviations:A, Agrobacterium; B, Bradyrhizobium; M, Mesorhizobium;R, Rhizobium.The accession numbers of the sequences of the reference strains are indicated within parentheses. Theaccession numbers for the test strains are listed in Table S3 in the Supplementary Material.