Origin of HIV-1 in Pan troglodytes troglodytes
Feng Gao1, Elizabeth Bailes2, David L. Robertson3, Yalu Chen1,
Cynthia M. Rodenburg1, Scott F. Michael1, Larry B. Cummins4, Larry O. Arthur5,
Martine Peeters6, George M. Shaw1,7, Paul M. Sharp2 & Beatrice H. Hahn1
1Departments of Medicine and Microbiology,
University of Alabama at Birmingham, USA
2Institute of Genetics,
University of Nottingham, United Kingdom
3Laboratory of Structural and Genetic Information,
CNRS, Marseilles, France
4Southwest Foundation for Biomedical Research,
San Antonio, Texas, USA
5AIDS Vaccine Program, National Cancer Institute-
Frederick Cancer Research and Development Center, USA
6Laboratoire Retrovirus,
ORSTOM, Montpellier, France
7Howard Hughes Medical Institute,
University of Alabama at Birmingham,
Birmingham,USA
Manuscript #H11134
METHODS
PCR Amplification and sequence analysis of SIVcpzUS.
Genomic DNA was extracted from frozen (- 20oC) spleen and lymphnode tissue obtained at autopsy, as described1. Nested PCR was used to amplify small (diagnostic) gag (508 bp) and pol (766 bp) fragments from spleen and lymphnode DNA using primer pairs designed according to HIV-1/SIVcpz consensus sequences2 and numbered according to SIVcpzGAB1 (ref. 3): gagA 5'-TGATAAAACATTTAGTAAGGGCAAG-3' (nucleotides (nt) 915-939); gagB 5'-TTATAGATGTCCCCTACTGGGA-3' (nt 1617-1638); gagC (same as gagA); gagD 5'-CTATCCCACTCTGCTGCTTCCTCATT-3' (nt 1466-1491); polA 5'-TAGGAAAGCTAAATTGGGCAAGTCA-3' (nt 3392-3416); polB 5'-ACCTGCCATCTGTTTTCCATA-3' (nt 5101-5121); polC 5'-CACAAAGGCATAGGAGGAAATGA-3' (nt 4225-4247); polD 5'- CTACTGCCCCTTCACCTTTCCACAG (nt 5014-5038). Amplification conditions included a hot start (94 oC 2 min), followed by 30 cycles of 94 oC, 1 min; 50 oC, 1 min; 72 oC, 1 min.
To obtain a complete genomic equivalent of SIVcpzUS, four overlapping fragments spanning gag/pol (3075 bp), pol/env (1022 bp), env (3099 bp), and nef/gag (2027 bp) were amplified from spleen DNA, using either regular nested (gag/pol: hot start; 94 oC, 1 min; 45 oC, 1 min; 72 oC, 8 min; 30 cycles) or "touchdown"4 PCR methods (all other fragments: hot start; 94 oC, 1 min; 65 oC, 0.5 min; 72 oC, 4 min; 40 cycles with 0.5 oC reduction of annealing temperature per cycle): gag/polA (same as gagA); gag/polB (same as polB); gag/polC 5'-CCCAGAACCTTAAATGCATGGGTAAA-3' (nt 1295-1327); gag/polD (same as polD); pol/envA 5'-TTTTCGGGTCTATTACAGGGACAGC-3' (nt 4956-4980); pol/envB 5'-CCTGCTGGDGCACAATARTGTATDGGAATDGGNTCAAA-3' (nt 6913-6950); pol/envC 5'-GCAGAGATCCAATTTGGAAAGGACC-3' (nt 4979-5003); pol/envD 5'-TCCTGCCATAGGAGATTCCTAAGCC (nt 6017-6041); envA 5'-AGCCAGCCTATGACTGCTTGCAATAATTGCTAC-3' (nt 5939-5971); envB 5'-CCCTTCCAGTCCCCCCTTTTCTTTTA-3' (nt 9141-9166); envC 5'-TGTAAAAAGTGTTGCTTTCACTGTGTGG-3' (nt 5972-5999); envD (same as envB); nef/gagA 5'-GTTCGCCCCTCAAGTACCATTAAGGCCC-3' (nt 9077-9103); nef/gagB 5'-CATAGTGTTGACATCTTGGGGAGTCGCC-3' (nt 1384-1411); nef/gagC (same as nef/gagA); nef/gagD 5'-CCGGGTTAAAGGCCTTTTCTTCTACCGC-3' (nt 1322-1349). Amplified fragments were cloned into plasmid vectors and sequenced using the primer walking approach, cycle sequencing, and dye terminator methodologies. The SIVcpzUS proviral contig was assembled using the Sequencher program (GenBank accession number AF103818).
PCR Amplification and sequence analysis of chimpanzee mitochondrial DNA.
A 498 bp segment of the mitochondrial d-loop region (corresponding to positions 15998 through 16497 of the human mitochondrial sequence5) was amplified from PBMC (GAB1, GAB2, Noah) or spleen DNA (Marilyn) using single round PCR and primers 5'-CACCATTAGCACCCAAAGCT-3' (upstream) and 5'-CCTGAAGTAGGAACCAGATG-3' (downstream), and sequenced without interim cloning using cycle sequencing and dye terminator methodologies (GenBank accession numbers: GAB1/AF102683; GAB2/AF102684; Marilyn/AF102685; Noah/AF102687). This region was selected because it includes the first hypervariable domain of the control region which has been used extensively in the past for studies of chimpanzee phylogeny and subspecies classification6,7. Amplification conditions included a hot start (94 oC, 2 min), followed by 30 cycles of 94 oC, 1 min; 54 oC, 0.5 min; 72 oC, 1 min.
Sequence comparisons.
SIVcpzUS predicted protein sequences were aligned with the other known SIVcpz strains (GAB1, GenBank accession number X52154; ANT, U42720); representatives of HIV-1 groups M (isolates U455A/subtype A/accession number M62320; 92UG037/A/U51190; LAI/B/K02013; RF/B/M17451; 93BR025/C/U52953; C2220/C/U46016; ELI/D/X04414; 94UG114/D/U88824; 93BR020/F/AF005494; 90CF056/H/AF005496), N (YBF30/AJ006022), and O (ANT70/ L20587; MVP5180/L20571); and representatives of the other major primate lentivirus lineages: SIVsm/isolate H4/X14307; SIVmac/MM251/M19499; HIV-2/ROD/subtype A/M15390; HIV-2/EHO/B/U27200; SIVagm strains from vervet (VER155/M29975), grivet (GRI-1/M58410) and tantalus (TAN-1/U58991) monkeys; SIVsyk (173/L06042); and SIVmnd (GB1/M27470). SIVcpzGAB2 (U11495) sequences were included in an alignment of partial Pol protein sequences. Protein sequences were aligned using Clustal_X (ref. 8) with minor manual adjustments (also see proteome_aln.txt and pol_aln.txt). Complete proteome alignments were constructed by concatenating Gag, Pol, Vif, Env and Nef alignments; in the regions of gag-pol and pol-vif gene overlap, the Gag and Pol sequences, respectively, were excluded. For sequence comparisons, sites which could not be unambiguously aligned were excluded, as were sites with a gap in any sequence. Protein sequence diversity plots were calculated using a window size of 200 residues, moved in steps of 10 residues. Phylogenetic analyses were performed by the neighbor-joining and maximum likelihood methods. The neighbor-joining method9 was applied to protein sequence distances calculated by the method of Kimura, with 1000 bootstrap replicates, as implemented in CLUSTAL_X. The maximum likelihood method utilized the JTT model of amino acid replacement, was replicated five times with shuffled input order, and was implemented in MOLPHY10. Mitochondrial DNA sequences derived from the SIVcpz-infected chimpanzees were aligned with reference sequences for the four subspecies of the common chimpanzee, a bonobo chimpanzee, and a human6,7. The mitochondrial phylogeny was derived using the neighbor-joining method applied to pairwise sequence distances calculated using the Kimura two-parameter method implemented with DNADIST (transition/transversion ratio set to 10) from the PHYLIP package11.
REFERENCES
1.Li, Y. et al. Molecular characterization of human immunodeficiency virus type 1 cloned directly from uncultured human brain tissue: identification of replication-competent and -defective viral genomes. J. Virol.65, 3973-3985 (1991).
2.Human Retroviruses and AIDS 1997: A compilation and analysis of nucleic acid and amino acid sequences (eds. Kober, B. et al.) Theoretical Biology and Biophysics Group, Los Alamos, New Mexico, (1997).
3.Huet, T., Cheynier, R., Meyerhans, A., Roelants, G. & Wain-Hobson, S. Genetic organization of a chimpanzee lentivirus related to HIV-1. Nature (London)345, 356-359 (1990).
4.Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K. & Mattick, J. S. "Touchdown" PCR to circumvent spurious priming during gene amplification. Nucleic Acids Research19, 4008 (1991).
5.Anderson, S. et al. Sequence and organization of the human mitochondrial genome. Nature290, 457-465 (1981).
6.Morin, P. A. et al. Kin selection, social structure, gene flow, and the evolution of chimpanzees. Science 265, 1193-1201 (1994).
7.Gonder, M. K. et al. A new west African chimpanzee subspecies? Nature388, 337 (1997).
8.Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. & Higgins, D. G. The Clustal_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nuc. Acids Res. 24, 4876-4882 (1997).
9.Saitou, N. & Nei, M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol.4, 406-425 (1987).
10.Adachi, J. & Hasegawa, M. MOLPHY (a program package for MOLecular PHYlogenetics) version 2.2. Institute of Statistical Mathematics, 4-6-7 Minami-Azabu, Minato-ku, Tokyo 106, Japan, (1994).
11.Felsenstein, J. PHYLIP (Phylogeny Inference Package) version 3.5c.. Department of Genetics, University of Washington, Seattle, Washington (1992).