Supplementary Figures
Supplementary Figure 1 – Flow-chart of the performed analyses
Supplementary Figure 2 – CSF3R mutations validated in CMML patients. A - Location of mutations according to ENST00000373103 (863 amino-acids); B – E450fs (exon X); C – W547X (exon 13) ; D - P467S (exon 11); E - M696T (exon 17)
Supplementary Figure 3 – Kaplan Meier curves for overall survival of ASXL1 mutated patients with either SETBP1 or CSF3R mutation (blue) or mutation in neither gene (red).
Supplementary Figure 4 - CSF3R intron 15-16 variant in 196 chronic myelomonocytic leukemias. A. Comparison of clinical and biological characteristics of 33A/G and 163A/A cases. B, C: Kaplan Meier curves for Overall survival (B) and Acute Myeloid Leukemia (AML)-Free Survival (C) in A/A and A/G patients (log-rank test)
Supplementary Figure 5- CSF3R mutations in chronic myelomonocytic leukemia clones: Dynamics of subclones during myeloid differentiationin UPN 531 (female, 81 y, CMML-1). Each number at the top of bars indicates the number of single-cell derived colonies analyzed. HSC: hematopoietic stem cell; CMP: Common Myéloid Progenitor; GMP: Granulo-Monocytic Progenitor(underlined gene: homozygous mutation).
Supplementary Tables
Supplementary Table 1: Sequences of primers used for CSF3R sequencing
CSF3R / Forward primer / Reverse primerExon 3 / TGCACAGTGACAGACAAGGA / ATGTGGCAGTGCAAGGAAAT
Exon 4 / GGAAGGTGAGGCCTCTGAGT / GAATACAGGCGTGAGCCAAC
Exons 5-6 / CAGCTGGTCCCAGAGGAAG / TGTGTTTCCCTCTCCATTCC
Exons 7-8 / AGAGGGAGCTAAGGCAGAGC / GGCCTGGACTGGATACTGTT
Exon 9 / GCAGCCAACAGTATCCAGTC / CTCCCAGACCTGTTGGAGTC
Exon 10 / CCCACCTAGAGGCTCTCCTT / ACCCAGGCAGTCTAGCCTTT
Exon 11 / GATTTGAACCCAGGCTTCTG / TCTCTTGGGCAGTTCAGGTT
Exon 12 / GGCCCTAACAGAAGTGCCTA / TGGTAGGAAGGCAATGTTCC
Exons 15-16 / GTCTGGGAAGCCACAAGAAG / GACCAGGGGATTCAAAGTCA
Exons 15-16 / TGACTTTGAATCCCCTGGTC / CTTGGCTTCAGAAGGTGTCC
CSF3R_ex17 / ATGTGTCAGGCATGTGTGAG / AGCTAGCTCAGGCCTTTAAG
Supplementary Table 2: The transcrit CSF3R-004 ENST 00000373103 (863 amino-acids) was used as the reference for variant description. Previously described variants were re-numbered when appropriate according to this reference (column “variant”). The previously given numbers are indicated in a specific column.
CSF3R protein domain / Variant / Previously numbered as / Exon / Disease / ReferenceExtra
cellular / G>A G21R / 3 / Medulloblastoma / Robinson G et al, 2012
G>A D172N / 6 / Skin carcinoma / Durinck S et al, 2011
G>A R190H / 6 / Colon carcinoma / Cancer Genome Atlas Network, 2012
T>C Y196H / 6 / Thyroid carcinoma / Seshagiri S et al, 2012
C>T A208V / 6 / Colon carcinoma / TCGA research network, 2012
C>A P229H / P206H / 7 / SCN / Ward AC et al, 1999
T>C M231T / 7 / CMML / This study; unknown significance
C>T R233W / 7 / Colon carcinoma / Cancer Genome Atlas Network, 2012
C>T R296C / 7 / Colon carcinoma / Cancer Genome Atlas Network, 2012
C>T L285F / 8 / Thyroid carcinoma / Seshagiri S et al, 2012
G>A D320N / 8 / CMML / This study; constitutive variant
G>A E331K / 8 / CMML; / This study; unknown significance
G>T E331X / 8 / Lung carcinoma / Pfeifer et al, 2012
A>G Q346R / 9 / CMML / This study; unknown significance
G>C W356S / 9 / Lung carcinoma / Imielinski M et al, 2012
A>T E363D / 10 / Ovarian carcinoma / Cancer Genome Atlas Network, 2011
C>T R367W / 10 / Thyroid carcinoma / Seshagiri S et al, 2012
G>A R440Q / 11 / CMML / This study; unknown significance
Ins C E450fs / 11 / CMML / This study; somatic mutation
C>T P467S / 11 / CMML / This study; somatic mutation
G>A E480K / 11 / Glioblastoma / Cancer Genome Atlas Network, 2008
G>A W547X / 13 / CMML / This study; somatic mutation
T>C Y562H / 13 / CMML / This study; unknown significance
T618I / T595I / 15 / SCN / Beekman R et al, 2013
Trans
membrane / T640N / T617N / 15 / SCN, / Forbes LV et al, 2002;
T640I, T640N / T617I, T617N / 15 / AML / Beekman R et al, 2013
T640N / T617I / 15 / Neutrophilia / Plo I et al, 2009;
Intra
cellular / delR651 / 16 / SCN / Yokoyama T et al, 2005
G>A G683R / 17 / CMML / This study; constitutive variant
T>C M696T / 17 / CMML / This study; somatic mutation
G>A M696I / 17 / Head&Neck carcinoma / Stransky N et al, 2011
C>T R698C / 17 / CMML / This study; unknown significance
Q752-Q781 / Q702-Q731 / 17 / SCN – Hot spot / Germeshausen M et al, 2007
C>T T717M / 17 / Glioblastoma / Cancer Genome Atlas Network, 2008
C>T Q752X / Q702X / 17 / SCN / Cassinat B et al, 2004
C>T Q766X / Q716X / 17 / SCN / Dong F et al, 1994
C>T Q768X / Q718X / 17 / SCN / Dong F et al, 1995;
C>T Q768X / Q718X / 17 / AML / Carapeti M et al, 1997
C>T Q770X / Q720X / 17 / SCN / Dong Fet al, 1997
C>T Q776X / Q726X / 17 / SCN / Tidow N et al, 1997
C>T Q781X / Q731X / 17 / SCN / Dong F et al, 1995
Q801-Y814 / Q751-Y764 / 17 / SCN – Hot spot / Germeshausen M et al, 2007
G>A E835K / 17 / CMML / This study; constitutive variant
G>A E835K / E785K / 17 / AML / Carapeti M et al 1997
C>T A859V / 17 / Thyroid carcinoma / Seshagiri S et al, 2012
Supplemental references
- Beekman R, Valkhof M, van Strien P, Valk PJ, Touw IP. Prevalence of a new auto-activating colony stimulatingfactor 3 receptor mutation (CSF3R-T595I) in acute myeloid leukemia and severe congenital neutropenia.Haematologica. 2013; 98: e62-3.
- CancerGenomeAtlasNetwork. Comprehensive molecular characterization of human colon and rectal cancer.Nature 2012; 487: 330-7.
- CancerGenomeAtlas Research Network. Comprehensive genomic characterization defines human glioblastoma genes and core pathways.Nature 2008; 455: 1061-8.
- CancerGenomeAtlasResearchNetwork. Integrated genomic analyses of ovariancarcinoma.Nature 2011; 474: 609-15.
- Carapeti M,Soede-Bobok A,Hochhaus A,Sill H,Touw IP,Goldman JM,et al. Rarity of dominant-negative mutations of the G-CSF receptor in patients with blast crisis of chronic myeloid leukemia or de novo acute leukemia.Leukemia. 1997; 11: 1005-8.
- Cassinat B, Bellanné-Chantelot C, Notz-Carrère A, Menot ML, Vaury C, Micheau M, et al. Screening for G-CSF receptor mutations in patients with secondary myeloid or lymphoid transformation of severe congenital neutropenia. A report from the French neutropenia register.Leukemia 2004; 18: 1553-5.
- Dong F, Brynes RK, Tidow N, Welte K, Löwenberg B, Touw IP. Mutations in the gene for the granulocytecolony-stimulating-factor receptor in patients with acute myeloid leukemia preceded by severe congenital neutropenia.N Engl J Med 1995; 333: 487-93.
- Dong F, Hoefsloot LH, Schelen AM, Broeders CA, Meijer Y, Veerman AJ, Touw IP, Löwenberg B. Identification of a nonsense mutation in the granulocyte-colony-stimulatingfactor receptor in severe congenital neutropenia.Proc Natl Acad Sci USA 1994; 91: 4480-4.
- Durinck S, Ho C, Wang NJ, Liao W, Jakkula LR, Collisson EA,et al. Temporal dissection of tumorigenesis in primary cancers.Cancer Discov 2011; 1: 137-43.
- ForbesLV, Gale RE, Pizzey A, Pouwels K, Nathwani A,LinchDC. An activating mutation in the transmembrane domain of the granulocytecolony-stimulatingfactor receptor in patients with acute myeloid leukemia.Oncogene 2002; 21: 5981-9.
- Germeshausen M, Ballmaier M, Welte K. Incidence of CSF3R mutations in severe congenital neutropenia and relevance for leukemogenesis: Results of a long-term survey.Blood 2007; 109: 93-9.
- Ikewaki J, Kawano R, Sato T, Imamura T, Kohno K, Ogata M,et al. An acquired CSF3Rmutation in an adult chronic idiopathic neutropenia patient who developed acute myeloid leukaemia.Br J Haematol 2012; 157: 264-6.
- Imielinski M, Berger AH, Hammerman PS, Hernandez B, Pugh TJ, Hodis E,et al. Mapping the hallmarks of lung adenocarcinoma with massively parallel sequencing.Cell 2012; 150:1107-20.
- Peifer M, Fernández-Cuesta L, Sos ML, George J, Seidel D, Kasper LH, et al. Integrative genome analyses identify key somatic driver mutations of small-cell lung cancer. Nat Genet. 2012 Oct;44(10):1104-10.
- Plo I, Zhang Y, Le Couédic JP, Nakatake M, Boulet JM, Itaya M, et al. An activating mutation in the CSF3R gene induces a hereditary chronic neutrophilia.J Exp Med 2009; 206: 1701-7.
- Robinson G, Parker M, Kranenburg TA, Lu C, Chen X, Ding L, et al. Novel mutations target distinct subgroups of medulloblastoma.Nature 2012; 488: 43-8.
- Seshagiri S,Stawiski EW,Durinck S,Modrusan Z,Storm EE,Conboy CB,Chaudhuri S,Guan Y,Janakiraman V,Jaiswal BS,Guillory J,Ha C,Dijkgraaf GJ,Stinson J,Gnad F,Huntley MA,Degenhardt JD,Haverty PM,Bourgon R,Wang W,Koeppen H,Gentleman R,Starr TK,Zhang Z,Largaespada DA,Wu TD,de Sauvage FJ.Recurrent R-sponding fusions in colon cancer. Nature. 2012 Aug 30;488(7413):660-4
- Stransky N, Egloff AM, Tward AD, Kostic AD, Cibulskis K, Sivachenko A, et al. The mutational landscape of head and neck squamous cell carcinoma.Science 2011; 333: 1157-60.
- Tidow N, Pilz C, Teichmann B, Müller-Brechlin A, Germeshausen M, Kasper B, et al. Clinical relevance of point mutations in the cytoplasmic domain of the granulocytecolony-stimulatingfactor receptor gene in patients with severe congenital neutropenia.Blood 1997; 89: 2369-75.
- Ward AC, van Aesch YM, Gits J, Schelen AM, de Koning JP, van Leeuwen D, et al. Novel point mutation in the extracellular domain of the granulocytecolony-stimulatingfactor (G-CSF) receptor in a case of severe congenital neutropenia hyporesponsive to G-CSF treatment.J Exp Med 1999; 190: 497-507.
- Yokoyama T, Okamura S, Asano Y, Kamezaki K, Numata A, Kakumitsu H, et al. A novel mutation in the juxtamembrane intracellular sequence of the granulocytecolony-stimulatingfactor (G-CSF) receptor gene in a patient with severe congenital neutropenia augments GCSF proliferation activity but not through the MAP kinase cascade.Int J Hematol 2005; 82: 28-34.
Supplementary Table 3: Characteristics of patients with a validated CSF3R mutation
UPN / 68 / 121 / 311 / 531 / 631 / 656Age (years) / 68 / 66 / 81 / 81 / 74 / 79
Gender / M / M / F / F / M / M
WHO classification / CMML-1 / CMML-1 / CMML-1 / CMML-1 / CMML-1 / CMML-2
Extramedullary disease / No / No / N/A / No / No / No
WBC (109/L) / 14.3 / 8.3 / 7.4 / 17.7 / 26.7 / 6.7
ANC (109/L) / 7.4 / 5.2 / 3.7 / 9.9 / 13.0 / 2.1
Monocytes (109/L) / 5.7 / 1.1 / 2.1 / 3.4 / 10.8 / 2.8
IMC (%) / 0 / 1 / 0 / 2 / 3 / 0
Hemoglobin level (g/dL) / 14.0 / 7.8 / 8.4 / 14.5 / 10.9 / 9.7
Platelets (109/L) / 45 / 220 / 179 / 366 / 114 / 212
Karyotype / Normal / Normal / Normal / Normal / Normal / Complex, del7q
CSF3R mutation / W547X / M696T / E450fs / M696T / P467S / M696T
TET2 mutations / E1323X, R1440fs / Q810X
SRSF2 mutation / P95H / P95H / P95L
ASXL1 mutation / G646WfsX12 / G646WfsX12 / G646WfsX12 / Q760X / Q708X
Other mutated genes / NPM1, DNMT3A / JAK2 / NRAS, U2AF1
WHO: World Health Organization; WBC: White blood cell count; IMC: Immature myeloid cells.