Name ______Pd _____ Date ______
Foundations of Biology Mr. Thompson
Protein Synthesis Webquest
http://learn.genetics.utah.edu/content/begin/dna/transcribe/
Are you ready to transcribe a DNA sequence and translate into a protein?
The DNA that makes up the human genome can be subdivided into information bytes called ______. Each gene encodes a unique ______that performs a specialized function in the cell. The human genome contains more than ______genes.
Cells use the two-step process of ______and ______to read each gene and produce the string of amino acids that makes up a protein. The basic rules for translating a gene into a protein are laid out in the ______.
Basic Steps of Protein Synthesis
1. DNA molecule is unzipped by special enzymes that allow ______to be made from the DNA template.
2. The process of creating RNA from DNA is called ______.
3. Using the small DNA sequence (gene) below, transcribe (rewrite the code) for a RNA molecule
DNA Strand: ATTACGATCTGCACAAGATCCT
RNA Strand: ______Hint: Uracil replaces Thymine in RNA!
4. The mRNA strand produced will deliver the ______or recipe needed to make a specific protein.
5. Information is stored on the RNA molecule in a triplet code called a ______.
6. Codons are a sequence of ______nitrogen bases that code for a specific amino acid.
7. The mRNA strand will leave the nucleus and attach itself to a ______, the site of protein synthesis.
8. When attached to a ribosome, the process of ______will occur which is the process of translating the mRNA codons into specific proteins.
9. Translation always begins when tRNA bonds will the universal start codon ______.
10. ______is always the first amino acid that begins the formation of proteins.
11. tRNA’s main job is to translate mRNA’s code and ______/place the specific amino acid in the correct sequence based on the code.
12. After the AUG start codon is translated, the next three nucleotides (codon) are ______and another amino acid is added to the growing polypeptide.
13. Each sequence of three nucleotides corresponds with a ______amino acid.
14. Amino acids will continue to be added to the growing polypeptide (protein) until one the 3 ______codons are reached.
15. Continue Translating the mRNA strand produced in question #3, complete amino acid sequence below:
Methionine - ______-______-______- ______-______- STOP
16. Codons are found on mRNA and anitcodons are found on ______.
EX. If the mRNA codon is AUG, then the tRNA anticodon would be
UAC
17. What would the anticodon be for AUG?
18. What would the anticodon be for UUU?
19. What would the anticodon be for AAG?
20. What would the anticodon be for CCG?
If time is available, try transcribing and translating the virtual gene again!!!