The genotype is the plan (blueprint) for creating an organism. For example, your genotype is the entire genetic information you inherited from your mom and your dad.
The phenotype is the output / result of using the genotype plan. The whole organism is the “phenotype”, but we typically focus on a specific gene and refer to a specific phenotype for that gene (like the color of your hair, for example).
DNA is the primary heritable molecule for all cells. The genotype is the information stored in the DNA. Genotype information is stored just like words in a book:
1) It is physical – You can point to a word in a book and cut out with a scissors.
2) It is linear – books are organized as a long line of letters that are read one after the other
3) It has letters – there are four letters (nucleotides) in the DNA language: A,G,C, and T
4) It is organized into clusters of information – the line of letters in a book is organized into units of information called words, DNA information is broken up into units of information called genes.
5) Just like a word, a gene has more meaning than just a series of letters.
Each gene has a function. For example, the function of the aquaporin gene is to provide the code to make the Aquaporin proteins (the donut-shaped water channel in the cell membrane of each of your cells). Humans have about 30,000 genes. The function of most of these genes is to provide the information needed to make proteins.
You inherited 23 chromosomes (about 30,000 genes) from your mom and 23 chromosomes (the same 30,000 genes but different versions) from your dad. Each chromosome is one, linear, double-stranded DNA. The DNA is composed of a long series of nucleotide letters (A,G,C,T) (each chromosome is one long line of millions of nucleotides). The chromosomal DNA is organized as a series of genes similar to how the letters in a book are organized into words. Each gene has two parts, the promoter and the transcription unit. These are physical things that can be cut apart with molecular scissors (gene splicing). If you think of the transcription unit as like one word in a story, then the promoter tells where the word fits in the story. Because of the promoter, genes do not need to be organized in a special order along the chromosomes like words are ordered in a book. The genes can be scattered here and there along the chromosomes. The genetic information gets used at the appropriate time and place because the promoter for each gene tells when and where the word fits into the story.
This is what genetic information looks like in a chromosome.
ACCAGTGCATCGATCGATTTCGATCGATGCATGCCGCGATCGATGCATGCCGCGCGATCTAGG
In this artificial example, there are four “genes” shown but they are hard to spot because we don’t know the language. We can change the letters to our alphabet:
ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN
The genes are organized in a line just like words in a book but the words are still hard to spot because the spaces between words are filled with random letters.
ADFTKEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTPTHESTHIRDXZAPBROWN
Also, the words are not in the correct order for the story. The promoter is a part of each gene that tells what order the words are used in the story. The promoter tells where, when, and how much transcription should be done.
ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN
So the words get read out in the proper order:
ADFTHEBCRDFOURTHNDSFOXLLVSSECONDOPSQUICKIIIFIRSTTOTHESTHIRDXZAPBROWN
THE QUICK BROWN FOX
Genes that code for proteins that have related jobs, like the LDL receptor and LDL protein for example, aren’t located next to each other on the chromosome. Their position on the chromosomes doesn’t matter because the promoters control when, where, and how much to make.
It’s also very important to note that the example on this page is a shortened version. A real gene is a “word” that is thousands of letters (nucleotides) long.
transcription unit - the part of a gene that gets copied (transcribed) by RNA polymerase
coding region – For genes that make (encode) proteins, the coding region is part of the transcription unit. The coding region is the genetic information in the DNA that tells the specific structure (primary amino acid sequence) of the protein to be made. The aquaporin protein has a specific structure due to the primary amino acid sequence and the specific structure of a protein gives each protein a specific function. Again, the coding region provides the information for the primary acid sequence of the protein to be made.
promoter – the genetic information in the DNA that tells where, when, and how much the gene should be expressed.
So . . . each protein in your body (like Aquaporin, for example) gets made (synthesized) from a gene. The gene for each protein is composed of two important parts, the promoter and the coding region. The coding region has the information for making the protein and the promoter has the information for when, where, and how much of the protein should be made.
You inherited one copy of each of your genes from your mom and one from your dad. The genes from your mom and dad are similar but not identical. For example, you inherited two copies of the LDL receptor gene. They may be identical but there is a very good chance that some of the nucleotide letters are different between the two genes. In a population of organisms of the same species, there can be a variety of versions of each gene. Each version is called an allele. Different alleles of the LDL receptor gene can have differences in their coding region that lead to differences in their primary amino acid sequence that lead to differences in their structure that lead to differences in their function. The differences don’t change the basic function of the LDL receptor but, for example, one allele might code for a receptor that is somewhat damaged and only works half as well as the protein coded from a different allele. Wild-type is what we call the typical or “average” activity allele. We could say wild-type is equivalent to 100% activity. A change in the DNA within the gene is a mutation and produces a mutant genotype and that can affect the phenotype. If the mutant allele causes a decrease in gene function it is said to be a loss of function allele. Maybe the allele only works 50% as well as wild-type, or maybe only 15%, or maybe it doesn’t work at all (0% this complete loss of function is given a special name, a null allele). If the allele causes an increase above wild-type it is said to be a gain of function allele.
Mutant alleles are fairly easy to understand when the mutation affects the coding region because then an altered version of the protein get made. Mutations in the promoter can be more complex to understand because they change where, when, or how much of the gene gets made. Consequently they can have some very weird effects, like a fruit fly with an eye growing in the middle of its wing, for example.
Evolution is a change in the frequency of alleles in a population over generations. This can occur if some alleles are favored over others (natural selection). The range of activity of the alleles within a population provides the potential for all evolutionary change.
In organisms that undergo sexual reproduction like humans, there is one copy of each chromosome from the mom and one from the dad. The phenotype is a blend of these two. When we have a baby, just one of the two alleles we have for each gene gets passed on to the baby. Although the phenotype is a blend, the genotype does not get blended. In other words, you are a blend of your parents but in your cells each gene from your mom and from your dad are still separate.