Supporting Information
Investigation of the Effect of Difenoconazole on Human CYP3A4 Enzyme
Liumeng Pan1, 2, Liping Lu1, 2, Jingpeng Wang1, 3, Cunwu Zheng1, Yujie Fu1,Siyuan Xiao1, Yating Jin1, Shulin Zhuang1, 2, *
1 College of Environmental and Resource Sciences, Zhejiang University, Hangzhou 310058, China.
2Key Laboratory of Health Risk Factors for Seafood of Zhejiang Province, Zhoushan 316022, China.
3Guangzhou Key Laboratory of Environmental Exposure and Health, School of Environment, Jinan University, Guangzhou 510632, China.
* Correspondence should be addressed to: College of Environmental and Resource Sciences, Zhejiang University. Email: ; Tel: +86-571-8898-2344
In total 6 pages, 1 text,1 table, 3 figures.
Text S1. Chemicals and Reagents
Difenonconazole was purchased from Labor Dr. Ehrebstorfer GmbH (Germany) with the purity of 99%. Trizma® HCl, Trizma® Base and dimethylsulfoxide (DMSO, 99.5%) were purchased from Sigma (St. Louis, MO, USA). P450-Glo™ CYP3A4 Assay (Luciferin-IPA) was purchased fromPromega Corporation (Madison, WI, USA). The fetal bovine serum (FBS) and DMEM/High Glucose (1×)were purchased from GE Healthcare Life Sciences HyClone Laboratories (USA). The Gibco Penicillin-Streptomycin (100×) (10,000 U/mL Penicillin, 10,000 μg/mL Streptomycin) and 0.5% trypsin-EDTA (10×) were purchased from the Thermo Fisher Scientific, Inc. (USA). Theprimary rabbit-anti-human CYP3A4 antibody was purchased from Abcam Company(USA) and β-Actin was obtained from Cell Signaling Technology, Inc. (USA). Trizol and PowerSYBR® Master Mix were purchased from Invitrogen Corporation (USA).RNase-Free DNase I was purchased from QIAGEN, Inc. (USA). All other chemicals and solvents were of analytical or HPLC grade. The Milli-Q water (Millipore) was used throughout the experiment.
Table S1.Real-Time PCR Primers and Conditions
Gene / Genbank Accession / Primer Sequences(5'to3') / Size(bp) / Annealing (°C)Human CYP3A4 / NM_017460 / CGATCATTGCTGTCTCCAACCTTCA / 100 / 64
CCCGCCTCAGATTTCTCACC
Human 18S / NR_003286 / GACTCAACACGGGAAACCTCAC / 122 / 64
CCAGACAAATCGCTCCACCAAC
Fig.S1. The structure of difenoconazole.
Fig. S2. The amplification curve of Human CYP3A4
Fig. S3. The melt curve of Human CYP3A4
1