SUPPLEMENTARY INFORMATION
Extracellular Calumenin SuppressesERK1/2 Signaling and Cell Migration byProtectingFibulin-1 from MMP-13-mediated Proteolysis
Qiao Wang,1 Birong Shen,1 Liang Chen,1 Pengli Zheng,1 Hui Feng,1 Qingsong Hao,1 Xiao Liu,1Lin Liu,1Sizheng Xu,1 Junlin Teng,1 and Jianguo Chen1,2
1State Key Laboratory of Bio-membrane and Membrane Bio-engineering; Key Laboratory of Cell Proliferation and Differentiation of the Ministry of Education, College of Life Sciences, Peking University, Beijing 100871, China; 2Center for QuantitativeBiology, Peking University, Beijing 100871, China
Figure S1.Overexpression of calumenin inhibits cell migration.(a)Wound healing assays of HeLa cells overexpressing the indicated EGFP-tagged calumenin constructs. Quantification of the wound sizes at the indicated times is shown(n=8). (b) BrdU incorporation assays of HeLa cells in the presence of HEK293T-cells-derived conditioned medium containing calumenin-1/2-EGFP. Quantification of BrdU positive nucleiis shown(n=10). Scale bar, 100 μm. (c)Transwellassays of MDA-MB-231 cells, with MCF-7 cells cultured in the lower chamber transfected with SP19-EGFP or calumenin-1/2-EGFP. Numbers of cells migrated to the lower side of transwells are shown(n=4). Scale bar, 100 μm. (d) Western blotting of total cell lysates and conditioned mediumfromB16/F10 cells stably expressing IRES-EGFPor calumenin-1/2-IRES-EGFP. (e) Wound healing assays of B16/F10 cells stably expressing IRES-EGFPor calumenin-1/2-IRES-EGFP, with the dishes coated with Matrigel. Wound sizes at the indicated times were measured (n=8). Scale bar, 100 μm. (f)In vivo imaging of mice 2 weekspost-injectionwith B16/F10 cells stably expressing IRES-EGFPor calumenin-1/2-IRES-EGFP. Intensities of EGFP signal at the sites of lungs are shown (n=12). (g and h) Representative tumors, tumor weight (g), and tumor volume (h) from nude mice 2 weekspost-transplantation subcutaneously with B16/F10 cells stably expressingIRES-EGFPor calumenin-1-IRES-EGFP(n=10). Calu, calumenin; CM, conditioned medium; Co.St., Coomassie blue staining; N131A, asparagine to alanine point mutation of calumenin-2 at position 131; SP19, signal peptide (amino-acids 1-19) of calumenin; TCL, total cell lysates; 293T, HEK293T cells. For (a), (b), (c) and (e), data are mean ± s.d.; for (f), (g) and (h), data are mean ± s.e.m., *p < 0.05, **p < 0.01, ***p < 0.001, n.s., not significant, determined by unpaired two-tailed Student’s t test.
Figure S2.Knockdown of calumenin enhances cell migration.(a and b) Western blotting of total cell lysates and conditioned medium (a) orTranswell assays (b) of B16/F0 cells stably expressing control or calumenin-1/2 shRNA. Numbers of cells migrated to the lower side of transwells are shown(n=4) (b). (c) Wound healing assays of control- or calumenin-1/2-shRNA-transfected B16/F0 cells. Wound sizes at the indicated times are shown (n=8). For (b) and (c), scale bars, 100 μm. Calu, calumenin; CM, conditioned medium; Co.St., Coomassie blue staining; TCL, total cell lysates. For (b) and (c), data are mean ± s.d., ***p < 0.001, determined by unpaired two-tailed Student’s t test.
Figure S3.Minimal domain of calumenin suppresses cell migration.(a) Quantification of wound sizes(n=8) of 15EGFP-tagged calumeninisoforms at the indicated time points post-scratching.The schematic pictures of the architecture of 15 calumenin isoforms are shown in the right panel.The black rectangles indicate the coding sequences. aa, amino-acid; +/−, isoforms suppressing/not suppressing cell migration in wound healing assays. (b) Western blottingof conditioned medium from B16/F10 cells stably expressing SP19-EGFP or calumenin-1-Δ14-EGFP. (c)Wound healing assays of B16/F10 cells stably expressing SP19-EGFP or calumenin-1-Δ14-EGFP.Scale bar, 100 μm. (d)In vivoimagingof mice 2 weekspost-injectionwith B16/F10 cells stably expressing SP19-EGFP or calumenin-1-Δ14-EGFP. Intensities of EGFP signal at the sites of lungs are shown. Calu, calumenin; CM, conditioned medium; Co.St., Coomassie blue staining; SP19, signal peptide (amino-acids 1-19) of calumenin.
Figure S4.Calumenin interacts with fibulin-1.(a)Conditioned medium and total cell lysates from calumenin-1-EGFP-transfected HEK293T cells were immunoprecipitated with anti-EGFP antibody, and analyzed by SDS-PAGE and LC-MS/MS. Candidates with high scores are shown. (b)Schematic picture of fibulin-1 isoforms. Ring, anaphylatoxin-like module; rectangle, calcium-binding EGF-like repeat. (c) Amino acid sequences of fibulin-1C and fibulin-1D. Peptides detected in LC-MS/MS analysis are marked inred. The underlined amino acids indicate different regions between fibulin-1C and fibulin-1D. (d) Yeasttwo-hybrid assays of calumenin-2 and fibulin-1. (e)Western blotting of total cell lysates and conditioned medium from B16/F10 cells stably co-expressingcalumenin-1-IRES-EGFP and fibulin-1 shRNA. The relative mRNA levels of fibulin-1 are shown (n=3). (f) Wound healing assays of B16/F10 cells stably co-expressingcalumenin-1-IRES-EGFP and fibulin-1 shRNAat the indicated time points post-scratching. Scale bar, 100 μm.(g)Transwellassays of HeLa cells, with HEK293T cells in the lower chamber co-transfected with calumenin-1-IRES-EGFP and pcDNA3.1-fibulin-1 plasmids (n=4). (h)qRT-PCR analysis of HeLa cells co-transfected with calumenin-EGFP and MMP-13-3×flag plasmids (n=3). Calu, calumenin; CM, conditioned medium; SP19, signal peptide (amino-acids 1-19) of calumenin; TCL, total cell lysates. For (e), (g),(h) and (i), data are mean ± s.d., ***p < 0.001, n.s., not significant, evaluated by unpaired two-tailed Student’s t test.
Figure S5.Immunohistochemical analysis ofHCC and pancreatic carcinoma.(a) Western blotting analysis of total cell lysates and conditioned medium from MHCC97-L and MHCC97-H celllysates. (b and f) Summary of the relationships between calumenin-1/2 and fibulin-1 protein levels, patients’ gender, age and tumor grades in 75 HCC patients (b) and 74 pancreatic carcinoma patients (f). (c) Representative immunohistochemical staining ofcalumenin-1/2 and fibulin-1 in HCC tissues and adjacent normal tissues of different tumor grades. Scale bar, 100 µm.(d and e) Calumenin-1/2 (d) and fibulin-1 (e) expression were inversely correlated with HCC grades. Higher scores indicate greater reduction of calumenin-1/2 or fibulin-1 in HCC tissues.Data are mean ± s.d., p values are evaluated by unpaired two-tailed Student’s t test (n=46 or 29). Calu, calumenin; CM, conditioned medium; TCL, total cell lysates.
Table S1 Summary of analyses of calumenin and fibulin-1 protein levels in HCC tissues and adjacent normal tissues of 75 patients.
Patient ID / Gender / Age / Grade ofCancer / Calumenin-1/2
(score of reduced level) / Fibulin-1
(score of reduced level)
1 / Male / 63 / I / 2 / 1
2 / Female / 50 / I / 2 / 2
3 / Male / 57 / I / 0 / 0
4 / Male / 50 / I-II / 0 / 1
5 / Male / 37 / I-II / -1 / 1
6 / Male / 90 / I-II / 1 / 0
7 / Male / 56 / I-II / 2 / 1
8 / Male / 55 / I-II / 1 / 0
9 / Male / 62 / I-II / 2 / 1
10 / Female / 56 / I-II / 2 / 2
11 / Male / 57 / I-II / -1 / -1
12 / Female / 39 / I-II / 1 / 1
13 / Male / 52 / I-II / 2 / 2
14 / Male / 48 / II / 3 / 3
15 / Male / 65 / II / 3 / 2
16 / Male / 54 / II / 2 / 1
17 / Male / 23 / II / 1 / 1
18 / Male / 50 / II / 2 / 3
19 / Male / 72 / II / -1 / -1
20 / Male / 77 / II / -1 / 2
21 / Male / 54 / II / 2 / 1
22 / Male / 53 / II / 2 / 0
23 / Male / 68 / II / 1 / 2
24 / Male / 43 / II / 2 / 3
25 / Male / 47 / II / 1 / 3
26 / Male / 48 / II / 2 / 3
27 / Male / 48 / II / -2 / 2
28 / Male / 58 / II / 2 / 1
29 / Male / 65 / II / -1 / 3
30 / Male / 67 / II / 2 / 1
31 / Male / 40 / II / 1 / 1
32 / Male / 71 / II / 1 / 2
33 / Male / 70 / II / 0 / 2
34 / Male / 55 / II / 1 / 2
35 / Female / 52 / II / 3 / 2
36 / Male / 52 / II / -2 / 3
37 / Female / 72 / II / 0 / -1
38 / Male / 57 / II / 2 / 3
39 / Male / 44 / II / 1 / 2
40 / Female / 54 / II / 0 / 0
41 / Male / 57 / II / -1 / -1
42 / Male / 50 / II / -2 / 2
43 / Male / 48 / II / 1 / 3
44 / Male / 52 / II / 2 / 2
45 / Male / 52 / II / -1 / 0
46 / Male / 51 / II / 1 / 2
47 / Male / 41 / II-III / 1 / 1
48 / Male / 56 / II-III / 1 / 1
49 / Male / unknown / II-III / 2 / 2
50 / Male / 51 / II-III / 2 / 2
51 / Male / 53 / II-III / 1 / 2
52 / Male / 40 / II-III / 1 / 1
53 / Male / 53 / II-III / 3 / 2
54 / Male / 56 / II-III / 2 / 2
55 / Male / 57 / II-III / 0 / 3
56 / Male / 65 / II-III / 0 / 3
57 / Male / 38 / II-III / 2 / 3
58 / Male / 58 / II-III / 1 / 2
59 / Male / 58 / II-III / 2 / 2
60 / Male / 56 / II-III / 0 / 2
61 / Male / 39 / II-III / 1 / 1
62 / Male / 57 / II-III / 2 / 2
63 / Male / 51 / II-III / -1 / 2
64 / Male / 56 / II-III / 2 / 2
65 / Female / 58 / II-III / 0 / 3
66 / Male / 70 / II-III / 1 / 2
67 / Female / 80 / II-III / 2 / 0
68 / Male / 54 / III / 3 / 2
69 / Male / 51 / III / 3 / 3
70 / Male / 42 / III / 3 / 2
71 / Female / 52 / III / 1 / 0
72 / Male / 52 / III / 2 / 3
73 / Male / 57 / III / 2 / 3
74 / Male / 44 / III / 1 / 2
75 / Female / 57 / III / 1 / 0
Score of reduced calumenin and fibulinprotein levels determined by immunohistochemical stainingsin HCC tumor tissues compared with their adjacent normal tissues. 3, decrease dramatically; 2, decreasemoderately; 1, decreaseslightly; 0,noclear change; -1, increase slightly; -2, increasemoderately; -3, increase dramatically.
Table S2 Summary of analyses of calumenin and fibulin-1 protein level in 74 patients with pancreatic carcinoma.
Patient ID / Gender / Age / Grade ofCancer / Calumenin-1/2
(score of reduced level) / Fibulin-1
(score of reduced level)
1 / Male / 53 / WD / Y / N
2 / Female / 66 / WD / Y / Y
3 / Male / 54 / I / Y / O
4 / Male / 68 / I / Y / O
5 / Male / 47 / I / Y / Y
6 / Female / 51 / PI / Y / Y
7 / Female / 46 / I / Y / Y
8 / Female / 47 / I-II / O / Y
9 / Female / 63 / I-II / Y / O
10 / Female / 73 / I-II / Y / O
11 / Female / 55 / I-II / O / O
12 / Male / 59 / I-II / Y / Y
13 / Female / 43 / I-II / Y / Y
14 / Male / 75 / I-II / Y / Y
15 / Female / 67 / I-II / Y / Y
16 / Female / 53 / I-II / Y / O
17 / Female / 50 / I-II / Y / Y
18 / Male / 59 / I-II / O / O
19 / Male / 40 / I-II / Y / Y
20 / Female / 62 / I-II / Y / O
21 / Male / 35 / I-II / Y / Y
22 / Male / 62 / I / Y / Y
23 / Female / 39 / I-II / Y / Y
24 / Male / 81 / I-II / Y / Y
25 / Male / 78 / I-II / Y / O
26 / Female / 38 / I / Y / Y
27 / Male / 52 / I-II / Y / Y
28 / Male / 56 / I-II / Y / Y
29 / Female / 80 / I-II / Y / Y
30 / Female / 74 / I-II / Y / Y
31 / Male / 52 / III / O / Y
32 / Male / 49 / III / N / O
33 / Male / 66 / III / O / Y
34 / Female / 64 / III / N / N
35 / Male / 42 / III / O / N
36 / Male / 46 / DE / O / N
37 / Male / 66 / III / N / N
38 / Male / 63 / II / Y / O
39 / Male / 49 / II / Y / Y
40 / Male / 66 / II / Y / Y
41 / Male / 51 / II / N / Y
42 / Male / 71 / II / Y / Y
43 / Female / 58 / II / Y / Y
44 / Female / 40 / II / O / N
45 / Male / 58 / II-III / Y / Y
46 / Female / 45 / II-III / N / O
47 / Male / 73 / II-III / Y / Y
48 / Female / 72 / II-III / Y / Y
49 / Female / 71 / PD / O / Y
50 / Male / 50 / II-III / O / Y
51 / Male / 50 / PD / Y / Y
52 / Male / 56 / PD / N / N
53 / Male / 49 / PD / N / Y
54 / Male / 74 / II-III / Y / Y
55 / Male / 80 / II-III / O / O
56 / Male / 63 / III / Y / Y
57 / Male / 60 / III / Y / Y
58 / Male / 62 / III / O / Y
59 / Male / 50 / II-III / N / O
60 / Male / 80 / II-III / Y / O
61 / Male / 44 / III / N / Y
62 / Male / 57 / II-III / Y / Y
63 / Male / 57 / II-III / Y / Y
64 / Female / 34 / III / Y / Y
65 / Male / 57 / II-III / Y / Y
66 / Male / 67 / II-III / O / Y
67 / Male / 65 / II-III / Y / O
68 / Female / 55 / II-III / Y / Y
69 / Female / 59 / II-III / Y / Y
70 / Male / 57 / II-III / Y / Y
71 / Female / 58 / III / Y / Y
72 / Male / 55 / III / Y / O
73 / Female / 46 / III / Y / Y
74 / Male / 82 / AC / Y / Y
Changes of calumenin and fibulin protein levels determined by immunohistochemical stainingsin pancreatic carcinoma tissues compared with their adjacent normal tissues. Y, decrease; O,no change; N, increase. I~III, tubularadenocarcinoma grade I~III. WD, well-differentiated adenocarcinoma; PD, poorly differentiated adenocarcinoma; DE, ductal epithelial atypical hyperplasia; PI, pancreas interstitial fibroplastic hyperplasia; AC, adenosquamous carcinoma.
Table S3 Information of primers and siRNAs.
F-calu-1-EcoRI / GGG GAATTC ATGGACCTGCGACAGTTTCTTATG
R-calu-19-SalI / GGG GTCGAC GCTCAAGGCAAAGGCTGTGCAC
R-calu-141-SalI / GGG GTCGAC ATAATCAAAACTCTGAGCATCATTGT
F-calu-142-EcoRI / GGG GAATTC ATG GACCATGATGCCTTCTTGGGTG
R-calu-411-SalI / GGG GTCGAC GTAAGTGCCATAAGTCACGTTTCT
F-calu-412-EcoRI / GGG GAATTC ATG CTGGATGATCCAGATCCTGATGAT
R-calu-660-SalI / GGG GTCGAC ATGGCTGTACATGTCACCAATATAC
F-calu-661-EcoRI / GGG GAATTC ATG GATGGGAATACTGATGAGCCAGAA
R-calu-945-SalI / GGG GTCGAC GAACTCATCATGCCGTACTAAGG
F2-caluΔ4 / GTGCACAGCCTTTGCCTTGAGCGATGGGAATACTGATGAGCCAGAA
F2-caluΔ5 / GTGCACAGCCTTTGCCTTGAGCTACCTGGATGATCCAGATCCTGAT
F2-caluΔ6 / GACCATGATGCCTTCTTGGGTGC
R2-caluΔ6 / GCACCCAAGAAGGCATCATGGTCGCTCAAGGCAAAGGCTGTGCAC
Primers used for vector construction of fibulin-1D
F-Fibulin-1D-EcoRI / AAA GAATTC ATGGAGCGCGCCGCGCCGTC
R-Fibulin-1D-XhoI / AAA CTCGAG GAACCAGTACTCAGAGACGAAGAT
R-Fibulin-1D-178-XhoI / AAA CTCGAG GTCATTCAGATATGGGTCCTCTTGT
R-Fibulin-1D-578-XhoI / AAA CTCGAG GATGCAGCGGACCGTGTCTGTC
RNAitarget sequences
Scramble siRNA / TTCTCCGAACGTGTCACGT
Calu-RNAi1 / CGTTGACAAGTATGACTTA
Calu-RNAi2 / GATGAGCCAGAATGGGTAA
Calu-RNAi3 / GGAGTTTGATATGAATCAA
Calu-RNAi4 / ACGTGACTTATGGCACTTA
Fibulin-1-RNAi1 / AGACCGGAGATTTGGATGTCG
Fibulin-1-RNAi2 / AGAGGACCCATATCTGAATGA
Fibulin-1-RNAi3 / ACACGTGCCAGAAGAACGTGC
Fibulin-1-RNAi4 / TGTAGCATAAGGCCAACATGT
Primers used for quantitative real-time PCR
F-RT-Fibulin-1 / TCTGTCAGAATACTCTGGGATCCTT
R-RT-Fibulin-1 / CATCTTGTATAAAGCCACTCTTGCA
F-RT-GAPDH / GGCATCCTGGGCTACACTGA
R-RT-GAPDH / GGAGTGGGTGTCGCTGTTG
Primers used for RT-PCR detection of the expression levels of calumenin truncations
F-calu-1-EcoRI / GGG GAATTC ATGGACCTGCGACAGTTTCTTATG
R-GFP-50 / CTGGTCGAGCTGGACGGCGACG