Supplementary Document 2
Exon 14 deletion breakpoint characterisation
Through collaboration with the Hospital Vall d'Hebron in Barcelona, Spain we received a DNA sample from a patient suspected of having a PMS2 mutation. Utilising screening procedures available at the time we were unable to identify any causative mutation. Homozygosity was seen in exon 15, and the old version of the MLPA kit (P008-A1) showed abnormal probe signals for both exon 14 and 15, hence inclusion of the case in this study.
Following the identification of a putative exon 14 deletion with the current MLPA kit, we sought to confirm the deletion via PCR/sequencing. Using the long-range PCR products generated for the MLPA analysis as templates we performed nested PCRs using primers 3′ to exon 13 and 5′ to exon 15 at shorter and shorter intervals to exon 14. Given the preponderance of large scale deletion breakpoints being located in Alu repeats14we targeted primer locations relative to these.
A nested PCR product was generated from a primer located 375bp downstream of exon 13 (GAGCTGGGAATAATCTTTCAGGTCA) along with a primer located 1167bp upstream of exon 15 (GAGTCACACTAAACTCAGGACATCA) (Figure S1a). The wild type productsare 3561bp with a mutant band appearing at around 1.8kb. Further nesting of primers at the 3′ end allowed for the production of a deletion specific short range PCR (Figure S1b) with the reverse primer located 2380bp upstream of exon 15 (ACCATCTCACCTGGTCACCATGTTT).Subsequent sequencing of the PCR productcharacterised the deletion to be located atc.2276-113_c.2245+1596del (Figure S1c). All nucleotide positions are relative to genomic fragment AC005995.3.
Figure S1. Characterisation of aPMS2 exon 14 deletion. (A)Gel image showing amplicons spanning the exon 14 loci using both PMS2 and PMS2-CL specific long-range PCR products as templates. (B) Breakpoint specific PCR product amplified directly from whole genomic DNA. (C) Sequencing chromatogram across the breakpoint (red arrow), with a schematic of the homologous flanking intronic sequences below. Yellow text highlights the sequence differences between the two regions with the mutated sequence being underlined. Note that the actual breakpoint could occur anywhere within the 12bp of identical sequence between the two regions. The red nucleotide in intron 13 shows the position of SNP rs9655490 for which the patient carries the minor allele (data not shown).