Supplementary Table 1. Primer sequences and predicted length of amplicons used in this study
Gen / Primer / Sequence (5' - 3') / PCR product size(bp)1 / Annealing temperature
(ºC) / Primer sequences obtained from
s-HlMYB3 / HlMYB3-1-F / gacgtcaacagcaagcaattc / 201 / 60 / Matoušek et al. 2007
HlMYB3-1-R / ggcctctgacgtgtctgatg
HlMYB3-2-F / catggacggttgaggaagat / 214 / 60 / This study
HlMYB3-2-R / ttaccccaccgagaatgaag
HlMYB1 / HlMYB1-1-F / ctcaacttggctcggttctc / 209 / 60 / This study
HlMYB1-1-R / ctggtgttcccatttgttcc
HlMYB2 / HlMYB2-1-F / tagtgggtcagagtacagtgctcat / 233 / 60 / Matoušek et al. 2012
HlMYB2-1-R / caacctcgagaagctgctgata
HlMYB7 / HlMYB7-1-F / accaacacgaccaccacaat / n.a / 60 / Matoušek et al. 2012
HlMYB7-1-R / tgcggataaggagggctaat
HlbZip1 / Hl-bZip1-1-F / agtggtacttcgggcagagg / 182 / 60 / Matoušek et al. 2010
Hl-bZip1-1-R / cgtgctttctcatcctccag
HlbZip2 / HlbZip2-1-F / tcactctgatcgacccgac / 200 / 60 / Matoušek et al. 2010
HlbZip2-1-R / aagcagaaagtcctcgagc
HlbHLH2 / HlbHLH2-1-F / gaccagcggagcgggttgac / 156 / 60 / This study
HlbHLH2-1-R / ctctggccgagttgacggcg
HlWDR1 / HlWDR1-1-F / ttgcttagattggcttggaataa / 188 / 60 / Matoušek et al. 2012
HlWDR1-1-R / ccggctgagcagatatgtctat
PAL / HlPAL-1-F / ccgaagtcttgtcagccatt / 226 / 60 / This study
HlPAL-1-R / tggggtgatgtcctaagagc
C4H / HlC4H-1-F / ccactggaagaagccagaag / 176 / 60 / This study
HlC4H-1-R / tctgcaccaaacgtccaata
4CL / Hl4CL-1-F / tccgatagccttaacggttg / 156 / 60 / This study
Hl4CL-1-R / ccatagccctgtccaagtgt
CHS_H1 / CHS-H1short-S / atcactgccgtcactttc / 250 / 55 / Matoušek et al. 2006
CHS-H1short-AS / aaataagcccaggaacatc
CHI / CHIshort-S / caactgccctcaactcaa / 127 / 56 / Gatica-Arias et al. 2012b
CHIshort-AS / tttcttcctcaagccaac
F3H / HlF3H-2F / cacctgaaacagtccccaat / 185 / 60 / This study
HlF3H-2R / gggagaaaactctccgatcc
F3´H / F3´Hshort-S / tcaggtccacgatgccaatt / 147 / 60 / Gatica-Arias et al. 2012b
F3´Hshort-AS / gccggagaaaagatgaacagaa
FLS / HlFLS-2-F / atcactggggaagcttgttg / 154 / 60 / This study
HlFLS-2-R / gtaaggatgtcgtggccagt
F3´5´H / HlF3´5´H-1-F / ggaaacttttcaggcaccaa / 181 / 60 / This study
HlF3´5´H-1-R / tgcactcgtttgagtggaag
OMT1 / OMT1-S / taaaggaacagtggtggacgttg / 186 / 60 / Nagel et al. 2008
OMT1-AS / accgcatcagcactaggaattga
HlPT1 / HlPT1-1-F / cgacctcctgaatctggaaa / 192 / 60 / This study
HlPT1-1-R / cattcccaagagtgccctaa
VPS / VPS-S / gttatgccggtggaaaa / 298 / 55 / Matoušek (personal communication)
VPS-AS / ccggcttccgttacg
GPPS.LSU / GPPS.LSU-S / cattccaaaccccaaaacaaa / n.a / 60 / Wang and Dixon 2009
GPPS.LSU-AS / gactgcggaaatggatgaaaa
7SL-RNA / Hl-7SL-RNA-F / tgtaacccaagtgggggg / 160 / 60 / Maloukh et al. (2009)
Hl-7SL-RNA-R / gcaccggcccgttatcc
GAPDH / GAPDH_S / accggagccgactttgttgttgaa / 165 / 60 / Nagel et al. 2008
GAPDH_AS / tcgtactctggcttgtattccttc
n.a: Data not available
1 The tool PCR Products from the Sequence Manipulation Site was used to determinate the size of the amplicons (
