Wimmer Et Al. Supplemental Figures

Wimmer Et Al. Supplemental Figures

Wimmer et al. Supplemental Figures

figures SOR 20arena pdf

Supplementary Figure 1. Apparatus used for object location memory experiments. The arenas are 30’’ squares made of plexiglass. The objects were affixed to the floor using double sided tape. For object location experiments, a single cue is affixed to one of the walls of the apparatus. No cues are present for object recognition experiments.

figures Supp 20figs Litter 20size 20and 20growth png

Supplementary Figure 2.Paternal cocaine taking did not affect litter size, sex ratio or growth curves of progeny. a. Litter size is not affected by siring (t(43)=0.1215, p=0.9038) and the sex ratio (proportion of males) is unchanged comparing saline- to cocaine-sired offspring (t(44)=0.4806, p=0.6332; n=22-24 litters). b. Shown are the weights of saline- and cocaine-sired pups starting at P2 and up until weaning (male and female combined). There are no differences between saline- and cocaine-sired offspring (F(1,7)=0.001162, p=0.9738; n=68 pups from 5 litters for cocaine-sired offspring; 76 pups from 5 litter for saline-sired progeny). c. Adult animals were weighed weekly following weaning. There was no effect of siring on growth curves for male (F(1,62)=0.1606, p=0.69; n=29-35 from 5 litters) or female (F(1,50)=0.6327, p=0.4301; n=22-30 from 5 litters) F1 offspring. There was an overall difference in growth curve between male and female offspring (F(1,114)=332.2, p<0.0001).

figures Supp 20figs LTP 20F1 20females 20theta 20slope 20 png

Supplementary Figure 3. Cocaine-sired female F1 offspring showed unalteredLTP. a. Input-output curves were recorded by measuring the initial slope of fEPSP in response to stimuli of increasing intensities in male F1 offspring. There were no differences comparing saline-sired to cocaine-sired slices (F(1,16)=0.0503, p=0.8253; n=9 per group, representing a minimum of 5 litters). b. Both saline- and cocaine-sired female progeny showed theta burst-induced LTP (Time, F(67,938=11.30, p<0.0001, Interaction between time and sire F((67,938)=0.3220, p>0.9999; n=7-9 representing a minimum of 4 litters for each group).

figures Supp 20figs Glutamate 20qPCR 20hipp 20F1 20males png

Supplementary Figure 4. Paternal cocaine exposure did not change total D-serine levels in PFC and cerebellum and did not alter the expression of enzymes involved in the glutamine-glutamate cycle.

a.D-serine levels are unchanged by paternal cocaine exposure in the PFC (t(10)=0.1062, p=0.9176) or cerebellum (t(10)=0.8355, p=0.4230) of F1 male offspring (n=6 per group, representing 6 litters). b. Hippocampal D-serine content is unchanged by paternal cocaine taking in female F1 progeny (t(10)=0.5910, p=0.6266; n=6 per group, representing 6 litters). c. Gene expression of Gld1, Gls and Gria1 was not changed by paternal cocaine exposure (F(1,13)=0.2667, p=0.6142; n=7-8, representing no less than 6 litters). d. NR1 protein expression is unchanged in cocaine-sired rats relative to saline-sired rats (t(10) = 0.205, p = 0.8417). The inset includes representative Western blot images from each group (n=6 per group, representing no less than 5 litters).

figures Supp 20figs Control 20ChIP 20figure png

Supplementary Figure 5. Paternal cocaine exposure did not elicit non-specific epigenetic remodeling. a.Acetylation of lysine 9 on histone H3 (H3K9ac) is not affected by paternal cocaine experience near the Dao1 locus (Interaction between sire and distance F(2,16)=0.01965, p=0.9806; n=5-6).b. Acetylation of histone H3 at the Syp promoter is not changed by cocaine siring (t(10)=0.3870, p=0.7069l; n=6). Single methylation of lysine 4 on histone 3 (H3K4me1) in samples prepared from saline- and cocaine-sired progeny (t(10)=0.4963, p=0.6304, n=6).

SupplementaryTable 1. Taqman expression assays used for qPCR experiments.

Gene / Probe ID
Grin1 / Rn01436038_m1
Grin2a / Rn00561341_m1
Grin2b / Rn00680474_m1
Srr / Rn01648369_m1
Dao / Rn00671228_m1
Actb (housekeeper) / Rn00667869_m1
Hprt1 (housekeeper) / Rn01527840_m1
Tuba4a (housekeeper) / Rn01400332_g1

Supplementary Table 2. Primers used for chromatin immunoprecipitation experiments.

Pimer / Sequence
Dao1 – 1kb F / CGTGCTTCCTTCATTGTGGTG
Dao1 – 1kb R / AGAGACGAAAGCAGCAGGAC
Dao1 TSS F / GGCTTGGGATCAGCCAGAAA
Dao1 TSS R / CACCAGCTAGGACTGGAACG
Dao1 +1kb F / CCTCCTCGTTACGGCTGTTT
Dao1 +1kb R / CCCGATTCAGCCCGAATGTA
Synaptophysine F / TCATCTGGTAGAACTGAGCGGTC
Synaptophysine R / GAGGCTGTGGGTTTTAGAGGAA

Supplementary Table 3. Total time exploring objects was not changed by paternal cocaine exposure. Total time (in seconds) exploring both objects was computed for every object location memory and novel object experiments. Locomotor activity (number of crosses) was also assessed during a habituation session.

TASK / FIGURE / SALINE-SIRED
Time (s) or
# of crosses / COCAINE-SIRED
Time (s) or
# ofcrosses / p-value
Object place
F1 males
Long-term (24H) / 1c / 48.08 ± 7.49 s / 52.06 ± 6.42 s / 0.6804
Object place
F1 males
Short-term (30 min) / 1d / 80.31 ± 12.93 s / 76.49 ± 11.5 s / 0.8155
Novel object
F1 males
Long-term (24H) / 1f / 169.61 ± 14.22 s / 155.257 ± 21.74 s / 0.5819
Novel object
F1 males
Short-term (30 min) / 1g / 66.98 ± 8.76 s / 53.37 ± 12.61 s / 0.3823
Object place
F1 females
Long-term (24H) / 2b / 57.32 ± 7.99 s / 56.42 ± 6.17 s / 0.9249
Novel object
F1 females
Long-term (24H) / 2d / 205.01 ± 15.82 s / 179.35 ± 28.25 s / 0.4465
Object place
F1 males
Short-term + Vehicle / 5c / 109.62 ± 24.80 s / 121.68 ± 21.59 s / F(1,28)=0.6075 P=0.4406
Object place
F1 males
Short-term + D-serine / 86.20 ± 6.41 s / 127.71 ± 20.61 s
Habituation for
Object place
F1 males (24 hours) / 1c / 47.78 ± 4.75 crosses / 55.63 ± 3.53 crosses / 0.2078

Supplementary Table 4. Performance on the object location memory task of animals selected for LTP experiments was representative of overall performance for each group.

Sire / preference on object location task
saline / 67.53
saline / 74.21
saline / 61.3
saline / 70.72
average performance for animals used in LTP experiments / 68.44
overall average of object location experiment / 65.64
cocaine / 60.12
cocaine / 52.43
cocaine / 46.19
cocaine / 56.12
cocaine / 50.38
cocaine / 42.97
cocaine / 67.65
average performance for animals used in LTP experiments / 53.69
overall average of object location experiment / 49.95

Supplementary Table 5. Amino acid screen of naïve hippocampi from adult F1 male offspring. Values are reported in nmol/mg of protein.

AMINO ACID / SALINE-SIRED / COCAINE-SIRED / Adjusted
P-VALUE
Ala / 10.10 ± 0.62 / 7.41 ± 1.21 / > 0.99
Arg / 3.74 ± 0.29 / 2.65 ± 0.56 / >0.99
Gln / 56.31± 1.97 / 23.10 ± 4.65 / 0.034
Ile / 0.51 ± 0.03 / 0.37 ± 0.06 / >0.99
Lactate / 132.62 ± 10.1 / 126.85 ± 6.25 / 0.6364
Leu / 1.08 ± 0.06 / 0.79 ± 0.15 / >0.99
Lys / 2.95 ± 0.27 / 1.73 ± 0.38 / >0.99
Orn / 0.32 ± 0.02 / 0.21 ± 0.04 / >0.99
Phe / 0.65 ± 0.04 / 0.50 ± 0.09 / >0.99
Thr / 7.20 ± 0.22 / 5.44 ± 1.21 / >0.99
Tyr / 1.71 ± 0.07 / 1.30 ± 0.25 / >0.99
Val / 1.00 ± 0.06 / 0.75 ± 0.13 / >0.99

SupplementaryTable 6. Quantitative characterization of single histone PTMs in the hippocampus of F1 male progeny. Enriched PTMs are shown in bold font.

PTM / Log2 coc/sal / -Log2 MW test
H3K9me2 / -0.0253 / 1.0000
H3K79me2 / -0.0390 / 1.0000
H3K9me1 / -0.0289 / 1.1963
H3K79me1 / -0.0311 / 1.1963
H3K4me2 / -4.5608 / 1.4174
H3K122ac / 2.3426 / 1.4174
H3K9me3 / 0.1278 / 1.6644
H3K27me2 / 0.1812 / 1.6644
H4K12ac / -0.1091 / 1.6644
H3K4ac / -3.5100 / 1.9383
H3K36me1 / -0.1623 / 1.9383
H3.3K36me1 / -0.1511 / 1.9383
H3.3K27me2 / 0.3450 / 1.9383
H4K8ac / -0.3553 / 1.9383
H4K20me2 / 0.2005 / 1.9383
H3K23ac / 0.1238 / 2.2401
H3.3K27me1 / 0.3628 / 2.2401
H3K56ac / 0.4593 / 2.2401
H3K27me3 / 0.0432 / 2.5706
H3.3K27me3 / 0.3820 / 2.9305
H4K5ac / -0.3330 / 2.9305
H4K20me1 / 0.8926 / 3.1218
H3K36me2 / 0.6869 / 3.3206
H3K79ac / -3.1794 / 3.3206
H4K20me3 / 0.3495 / 3.3206
H3K14ac / 0.2564 / 3.7414
H3K18ac / 0.2889 / 4.1934
H3.3K36me2 / 0.6704 / 4.1934
H3K27me1 / 1.1679 / 4.6773
H3K4me1 / 0.8403 / 5.1933
H4K16ac / 0.2764 / 5.1933
H3K9ac / 0.8445 / 6.3234
H3K18me1 / 1.3394 / 6.3234
H3K23me1 / 1.3125 / 8.2686