Supplementary MaterialJiwan et al
ContentsPages
1. Supplementary Table 12-10
2. DNA Gel BlotAnalysis11
3. Agrobacterium contamination test11
4. Alignment of DAJP13 and DAJP14 to MLO homologs in Fragaria vesca12
Section 1.
Supplementary Table 1. Gene copies included in the phylogenetic analyses of Mlo. Abbreviations for the genes either follow those used previously, or are arbitrarily designated in order to apply unique names to all gene copies in the figures.
Species / Figure Name / GenBankArabidopsis thaliana / AtMlo1 / NP_192169
A. thaliana / AtMlo2 / NP_172598
A. thaliana / AtMlo3 / NP_566879
A. thaliana / AtMlo4 / NP_563882
A. thaliana / AtMlo5 / NP_180923
A. thaliana / AtMlo6 / NP_176350
A. thaliana / AtMlo7 / NP_179335
A. thaliana / AtMlo8 / NP_565416
A. thaliana / AtMlo9 / NP_174980
A. thaliana / AtMlo10 / NP_201398
A. thaliana / AtMlo11 / NP_200187
A. thaliana / AtMlo12 / NP_565902
A. thaliana / AtMlo13 / NP_567697
A. thaliana / AtMlo14 / NP_564257
A. thaliana / AtMlo15 / NP_181939
Brachypodium distachyon / BdMlo1-1 / XP_003558907
B. distachyon / BdMlo1-2 / XP_003558908
B. distachyon / BdMlo1-like1 / XP_003581276
B. distachyon / BdMlo1-like2 / XP_003571073
B. distachyon / BdMlo4 / XP_003577771
B. distachyon / BdMlo8 / XP_003574266
B. distachyon / BdMlo14 / XP_003579492
B. distachyon / BdMlo15-1 / XP_003575162
Brassica rapa / BrMlo1 / AAX77014
Capsicum annuum / CaMlo1 / AAX31277
Chlamydomonas reinhardtii / CrMlo / XP_001689918
Cucumismelo / CmMlo1 / ACX55084
Eutremahalophilum / EhMlo1 / BAJ34386
E. halophilum / EhMlo2 / BAJ34234
E. halophilum / EhMlo3 / BAJ33971
E. halophilum / EhMlo4 / BAJ33805
Fragaria vesca / Fv_p09621
F. vesca / Fv_p09623
F. vesca / Fv_p10531
F. vesca / Fv_p12974
F. vesca / Fv_p23134
F. vesca / Fv_p29691
F. vesca / Fv_p31172
Glycine max / GmMlo1-1 / XP_003522288
G. max / GmMlo1-2 / XP_003527594
G. max / GmMlo1-3 / XP_003547751
G. max / GmMlo1-4 / XP_003523525
G. max / GmMlo1-5 / XP_003520359
G. max / GmMlo3-1 / XP_003520647
G. max / GmMlo3-2 / XP_003553544
G. max / GmMlo4-1 / XP_003538881
G. max / GmMlo4-2 / XP_003516545
G. max / GmMlo5-1 / XP_003523524
G. max / GmMlo5-2 / XP_003527633
G. max / GmMlo6-1 / XP_003555433
G. max / GmMlo6-2 / XP_003540745
G. max / GmMlo8-1 / XP_003517123
G. max / GmMlo8-2 / XP_003517124
G. max / GmMlo8-3 / XP_003548777
G. max / GmMlo8-4 / XP_003534232
G. max / GmMlo11-1 / XP_003526073
G. max / GmMlo11-2 / XP_003543248
G. max / GmMlo12-1 / XP_003526251
G. max / GmMlo12-2 / XP_003548913
G. max / GmMlo12-3 / XP_003548912
G. max / GmMlo12-4 / XP_003540949
G. max / GmMlo13 / XP_003546228
Hordeumvulgare / HvMlo1 / P93766
H. vulgare / HvMlo2 / BAJ97456
H. vulgare / HvMlo3 / AAS93431
H. vulgare / HvMlo4 / BAK00279
H. vulgare / HvMlo5 / BAK08220
Lotus japonicus / LjMlo1 / AAX77015
Malus domestica / Md_p119
M. domestica / Md_p123
M. domestica / Md_p141
M. domestica / Md_p145
M. domestica / Md_p146
M. domestica / Md_p163
M. domestica / Md_p168
M. domestica / Md_p191
M. domestica / Md_p196
M. domestica / Md_p207
M. domestica / Md_p239
M. domestica / Md_p928
Malus toringoides / MtMlo1 / ADV29809
Medicago truncatula / MtrMlo1 / ADV40949
M. truncatula / MtrMlo2 / XP_003612195
M. truncatula / MtrMlo3 / XP_003604071
M. truncatula / MtrMlo4 / XP_003603856
M. truncatula / MtrMlo5 / XP_003594424
M. truncatula / MtrMlo6 / XP_003592974
M. truncatula / MtrMlo7 / XP_003607521
M. truncatula / MtrMlo8 / XP_003636206
M. truncatula / MtrMlo9 / XP_003636497
M. truncatula / MtrMlo10 / XP_003636499
M. truncatula / MtrMlo11 / XP_003612408
M. truncatula / MtrMlo12 / XP_003603854
M. truncatula / MtrMlo14 / XP_003629098
Oryzaalta / OaMlo / ACN85277
O. australiensis / OauMlo / ACN85283
O. coarctata / OcMlo / ACN85293
O. granulata / OgMlo / ACN85338
O. nivara / OnMlo / ACN85176
O. officinalis / OoMlo / ACN85251
O. ridleyi / OrMlo / ACN85306
O. sativa / OsMlo1 / A2YD22
O. sativa / OsMlo2 / AAK94907
O. sativa / OsMlo3 / AAK72963
Ostreococcuslucimarinus / OlMlo / XP_001420898
Physcomitrella patens subsp. patens / PpaMlo1 / XP_001768083
P. patens subsp. patens / PpaMlo2 / XP_001784403
P. patens subsp. patens / PpaMlo3 / XP_001781175
P. patens subsp. patens / PpaMlo4 / XP_001776768
P. patens subsp. patens / PpaMlo5 / XP_001770178
P. patens subsp. patens / PpaMlo6 / XP_001763298
P. patens subsp. patens / PpaMlo7 / XP_001763297
P. patens subsp. patens / PpaMlo8 / XP_001754053
Pisum sativum / PsMlo1 / ACO07297
Populus trichocarpa / PtMlo1 / XP_002310696
P. trichocarpa / PtMlo2 / XP_002307201
P. trichocarpa / PtMlo3 / XP_002306989
P. trichocarpa / PtMlo4 / XP_002314276
P. trichocarpa / PtMlo5 / XP_002301907
P. trichocarpa / PtMlo6 / XP_002301905
P. trichocarpa / PtMlo7 / XP_002327651
P. trichocarpa / PtMlo8 / XP_002331489
P. trichocarpa / PtMlo9 / XP_002319210
P. trichocarpa / PtMlo10 / XP_002310695
P. trichocarpa / PtMlo11 / XP_002309708
P. trichocarpa / PtMlo12 / XP_002312021
P. trichocarpa / PtMlo13 / XP_002315295
Populus trichocarpax P. deltoides / PtxdMlo / ABK96389
Prunus americana / PaMlo1 / ACZ81392
P. americana / PaMlo2 / ACZ81391
P. persica / PpMlo1 / ACZ81390
P. persica / PpMlo2
P. persica / PpMlo3
P. persica / PpMlo4
P. persica / PpMlo5
P. persica / PpMlo6
P. persica / PpMlo7
P. persica / PpMlo8
P. persica / PpMlo9
P. persica / PpMlo10
P. persica / PpMlo11
P. persica / PpMlo12
P. persica / PpMlo13
P. persica / PpMlo14
P. persica / PpMlo15
P. persica / PpMlo16
Ricinus communis / RcMlo1 / XP_002533335
R. communis / RcMlo2 / XP_002510710
R. communis / RcMlo3 / XP_002510708
R. communis / RcMlo4 / XP_002517839
R. communis / RcMlo5 / XP_002522497
R. communis / RcMlo6 / XP_002526372
R. communis / RcMlo7 / XP_002526370
R. communis / RcMlo8 / XP_002533246
R. communis / RcMlo9 / XP_002532472
R. communis / RcMlo10 / XP_002530672
R. communis / RcMlo11 / XP_002528562
Selaginellamoellendorffii / SmMlo1 / XP_002961667
S. moellendorffii / SmMlo2 / XP_002963507
S. moellendorffii / SmMlo3 / XP_002965989
S. moellendorffii / SmMlo4 / XP_002965637
S. moellendorffii / SmMlo5 / XP_002967927
S. moellendorffii / SmMlo6 / XP_002971112
S. moellendorffii / SmMlo7 / XP_002972783
S. moellendorffii / SmMlo8 / XP_002981181
Solanumlycopersicum / SlMlo1 / NP_001234814
Sorghum bicolor / SbMlo1 / XP_002438667
S. bicolor / SbMlo2 / XP_002465008
S. bicolor / SbMlo3 / XP_002447339
S. bicolor / SbMlo4 / XP_002441108
S. bicolor / SbMlo5 / XP_002447908
S. bicolor / SbMlo6 / XP_002439069
S. bicolor / SbMlo7 / XP_002441107
S. bicolor / SbMlo8 / XP_002449108
S. bicolor / SbMlo9 / XP_002454019
S. bicolor / SbMlo10 / XP_002465934
Triticumaestivum / TaMlo1 / AAS93630
T. aestivum / TaMlo2 / AAK94904
T. aestivum / TaMlo3 / BAJ24148
T. aestivum / TaMlo4 / BAJ24149
T. aestivum / TaMlo5 / BAJ24150
T. aestivum / TaMlo6 / BAJ24151
T. aestivum / TaMlo7 / BAJ24153
Vitis vinifera / VvMlo / CAN84002
V. vinifera / VvMlo1-like / XP_002273002
V. vinifera / VvMlo4 / XP_002266927
V. vinifera / VvMlo5 / XP_002266377
V. vinifera / VvMlo5-like / XP_002273026
V. vinifera / VvMlo6 / XP_002274608
V. vinifera / VvMlo6-like / XP_002273434
V. vinifera / VvMlo7 / XP_002274642
V. vinifera / VvMlo9 / XP_002276608
V. vinifera / VvMlo10 / XP_002275360
V. vinifera / VvMlo11 / XP_002275390
V. vinifera / VvMlo12 / XP_002282198
V. vinifera / VvMlo13 / XP_002282216
V. vinifera / VvMlo14 / XP_002282190
V. vinifera / VvMlo15 / XP_002280697
V. vinifera / VvMlo16 / XP_002266144
V. vinifera / VvMlo17 / XP_002265520
Zea mays / ZmMlo1 / NP_001105660
Z. mays / ZmMlo2 / NP_001105168
Z. mays / ZmMlo3 / NP_001105527
Z. mays / ZmMlo4 / NP_001105169
Z. mays / ZmMlo5 / ACN34145
Z. mays / ZmMlo6 / NP_001105170
Z. mays / ZmMlo7 / NP_001105661
Z. mays / ZmMlo8 / NP_001105171
2. Section 2 –DNAGel Blot Analysis
Gel blot analysis was performed using standard protocols as described earlier (Sambrook et al., 2000). Briefly, 10 g of total DNA was digested with BglII restriction enzyme. DNA was electrophoresed on a 0.8% agarose gel. Prior to transfer to a membrane, the gel was depurinated, denautured and neutralized with prescribed solutions. DNA was transferred to Nylon membrane and crosslinked using a UV crosslinker (Stratagene Inc.). DNA was prehybridized and hybridized with a PpMLO1 gene probe as described previously (Dhingra et al., 2004). Hybridized blot was washed and processed for autoradiography. Expected fragments of 2.35 kb in Fa-pDAJ3 and 2.86 kb in Fa-pDAJ4 along with different sized higher fragments confirmed that these transgenics represented different transgenic events.
Supplementary Figure 1
References:
Sambrook J, MacCallum P, Russell D (2000) Molecular Cloning: A Laboratory Manual.3rd edn. Cold Spring Harbor Laboratory Press, NY
Dhingra A, Portis AR, Daniell H (2004) Enhanced translation of a chloroplast-expressed RbcS gene restores small subunit levels and photosynthesis in nuclear RbcS antisense plants. Proceedings of the National Academy of Sciences of the United States of America 101 (16):6315-6320
3. Section 3 - Agrobacterium contamination test
During Agrobacterium-mediated transformation, there is a possibility of bacterial contamination in the regenerated plants. The PCR results detailed above could be due to the presence of plasmid DNA within the contaminating bacteria. To eliminate the possibility of bacterial contamination, we used PCR with virB1 gene specific primers DAJP 11 and DAJP12 (Table 1). As shown in Supplementary Figure 2, positive amplification of a 300 bp region nested in the virB1 gene is only observed in the AGL0 host bacterial strain which was used at a very high dilution for PCR. Absence of the amplicon in samples labeled as Fa-pDAJ3.1-3.3 and Fa-pDAJ4.1-4.3 indicates the absence of Agrobacterium contamination in transgenic lines.
Supplementary Figure 2
Figure 2 – Assessment of Agrobacterium contamination
Primers annealing to virB1, DAJP11 and DAJP12 were used to test for presence of Agrobacterium. An amplicon of 300 bp was obtained when AGL0 strain was used as a template. The amplicon is missing in Fa-pDAJ 3.1-3.3 and Fa-pDAJ4.1-4.3 lines. Lane marked as M represents DNA ladder.
4. Section 4 - Alignment of DAJP13 and DAJP14 to MLO homologs in Fragaria vesca
Table shows the location and percentage identity of primers with MLO homologs predicted in Fragaria vesca. DAJP13 and DAJP14 are predicted to generate a 953 bp amplicon in Fragaria vescawith cDNA as a template. Note the complementarity at the GC-rich 3’ end of the primers.
Gene / DAJP13 / DAJP14 / %Identity DAJP13/DAJP14 / Amplicon size10995 / 686-708 / - / 79/-
12974 (PpMLO1 Homolog) / 1060-1083 / 130-157 / 79/71 / 953 bp
29691 / 1051-1074 / - / 79/-
31172 / 394-417 / - / 75/-
09621 / 613-634 / 806-831 / 67/64
09623 / 1547-1570 / - / 67/-
10134 / 1330-1358 / - / 66/-
10531 / 172-195 / 115-144 / 62/60
28466 / 1385-1408 / - / 62/-
23134 / - / 1477-1503 / -/61
Sequence alignment of DAJP13 and DAJP14 with gene12974 a PpMLO1 homolog predicted to be present in Fragaria vesca genome. Note the similarity at 3’end that is GC rich.
Query 28nt >DAJP13
Target 1674nt >gene12974
Qry 1 + AAAGTTGGAACGTTCCTCACGGATAGGC 28
| ||| ||||||| || | || ||||
Tgt 130 + ACAGTCGGAACGTGGCTTTCAGAGAGGC 157
28 cols, 20 ids (71.4%), 0 gaps (0.0%)
Query 24nt >DAJP14
Target 1674nt >gene12974
Qry 24 - CGGCCTCAGTTGGTTCTTCATTTT 1
|| || || |||||||||||| |
Tgt 1060 + CGACCGCACTTGGTTCTTCATCTC 1083
24 cols, 19 ids (79.2%), 0 gaps (0.0%)
1