METHODS

Study subjects

Each patient showed airway reversibility as documented by a positive bronchodilator response of a >15% increase in FEV1 and/or airway hyperreactivity to <10 mg/mL methacholine. The subjects were given a skin-prick test for 24 common inhalant allergens, including those related to house dust mites, Alternaria,Aspergillus, pollen, dog, cat, and cockroach. Atopy was defined as the presence of a wheal reaction of ≥3 mm in diameter to the allergen extract or equal to or greater than that to histamine (1 mg/mL). Total IgE was measured using the UniCAP system (Pharmacia Diagnostics, Uppsala, Sweden). There was no exacerbation or systemic steroid treatment within 6 weeks of the study.Oral aspirin challengewas performed with increasing doses of aspirin using previously described with slight modification. (1-2). Briefly, patients with a history of aspirin hypersensitivity were given 30 mg of aspirin orally, and those with no history were started on 100 mg aspirin orally. Respiratory and nasal symptoms, blood pressure, external signs (urticaria and angioedema), and FEV1 were documented every 30 min for a period of 1.5 h. In the absence of any symptom or sign suggesting an adverse reaction after 1.5 h, 100 mg aspirin was administered and the same measurements were repeated every 1 h with doses of 450 mg until the patient developed a reaction. If no reaction occurred by 4 h after the final dose, the test was deemed negative. Aspirin-induced bronchospasm, reflected by a decline (%) in FEV1, was calculated as prechallenge FEV1 minus postchallenge FEV1 divided by prechallenge FEV1.

cDNA synthesis and microarray hybridization

Ahuman oligonucleotide microarray (Genomictree, Korea) containing 34,560 oligonucleotide probes that represented human genes and gene transcripts was used for gene expression analysis. The 34,560 oligonucleotide probes were purchased from Qiagen. The synthesis of target cDNA probes and hybridization were performed according to a previously described protocol. Briefly, each 50 g of total RNA was mixed with 2 g of oligo-24N (dT) (GenoTech, Korea) in 15.4 L of RNase free water and incubated at 65C for 10 min. After incubation, the single-stranded cDNA was synthesized in the presence of Cy3-dUTP or Cy5-dUTP (1 mM each, NEN Life Science Products, Boston, USA) at 42C for 2 h. Total RNA from test samples and common reference RNA pooled from 10 normal samples were labeled with Cy5 and Cy3, respectively. Both Cy3- and Cy5-labeled cDNA were purified using PCR purification kit (Qiagen) as recommended by the manufacturer. The purified cDNA was resuspended in 100 L of hybridization solution containing 5SSC, 0.1% SDS, 30% formamide, 20 g of Human Cot-1 DNA, 20 g of poly A RNA, and 20 g of Yeast tRNA (Invitrogen). The hybridization mixtures were heated at 100C for 2 to 3 min and directly pipetted onto microarrays. The arrays were hybridized at 42C for 12 to 16 h in a humidified hybridization chamber (Genomictree, Korea). The hybridized microarrays were washed with 2SSC/0.1% SDS for 5 min, 0.1SSC/0.1% SDS for 10 min, and 0.1SSC for 2 min twice. The washed microarrays were immediately dried using a microarray centrifuge (Genomictree, Korea). The hybridized microarrays were imaged by using an Axon 4000B scanner (Molecular Devices, CA, USA). The signals and the background fluorescence intensities were calculated for each probe by averaging the intensities of every pixel inside the probe spot region using GenePix Pro 4.0 software (Molecular Devices). Spots of poor quality or indistinguishable signal level from the background were excluded. Data normalization and the selection of differentially expressed genes were performed using GeneSpring 7.3.1 (Agilent Technologies, Palo Alto, CA, USA).To analyze differentially expressed genes between control and test samples, the "Cross gene error model for replicates" was activated. Gene expression data was normalized in two ways: "LOWESS" and "per gene normalization". In "per gene normalization", the data from a given gene was normalized to the median expression level of the gene across all samples. The data sets were then assigned into two groups (control and test).

Real-time PCR for candidate genes

RNA was quantified using reverse-transcribed cDNA from 3 µg total RNA. RNA treated with DNase I (10,000 U/mL; Stratagene, La Jolla, CA) was reverse-transcribed by incubation with 0.5 mM dNTP, 2.5 mM MgCl2, 5 mM DTT, 1 µL random hexamer (50 μg/µL), and SuperScript II RT (200 unit/µL; Life Technologies, Grand Island, NY) at 42C for 50 min and heat-inactivated at 70C for 15 min. The primers for β-actin, GAPDH,CNKSR family member 3 (CNKSR3), spectrin, beta, nonerythrocytic 2 (SPTBN2), and impact homolog (IMPACT) were obtained using PrimerBank, a Primer3 web server ( The real-time PCR primer pairs for each are listed in Table1.

Table 1. Primer Table for three genes

Gene / Direction / Sequence
CNKSR3 / Forword / 5’- TCTCCTGCAGACAGATCTCAG -3’
Reverse / 5’-AGGGGAGCAGGAGTAAAGTTG-3
SPTBN2 / Forword / 5’-CCCTGGAGCCTGAAATGAAC -3
Reverse / 5’-GTCTCCGTGCACTCTAAGTG-3
IMPACT / Forword / 5’-CCAGGCCCAGATGTAAAGAAG -3
Reverse / 5’-CAAACCACTGGAGCCAAGTG-3
ACTB / Forword / 5’- GGACTTCGAGCAAGAGATGG – 3’
Reverse / 5’- AGCACTGTGTTGGCGTACAG – 3’
GAPDH / Forword / 5’- TGTTGCCATCAATGACCCCTT– 3’
Reverse / 5’- CTCCACGACGTACTCAGCG– 3’

CNKSR3 : CNKSR family member 3, SPTBN2 : spectrin, beta, non-erythrocytic 2, IMPACT : Impact homolog.

cDNA was aliquoted into tubes containing specific primer pairs for amplification using real-time PCR, performed with a StepOne Real-Time PCR System (Applied Biosystems). The reactions were prepared with 20 L PCR mixture consisting of 10 L master mix (iQ SYBR Green Supermix; Bio-Rad, Hercules, CA), 200 ng/L cDNA template, and 1 L each of CNKSR3, SPTBN2, and IMPACT gene primer pairs. Reactions were denatured at 95C for 10 min and amplified for 40 cycles at 95C for 15 s, 55C for 32 s, and 72C for 32 s. A melting curve for all products was obtained immediately after amplification by increasing the temperature in 0.3C increments from 60C for 85 cycles of 15 s each. The threshold cycle (Ct) of CNKSR3, SPTBN2, IMPACT, or endogenous reference genes was defined as the fractional cycle number at which the fluorescence of PCR products passes the fixed threshold. Using the 2ΔΔCt method, the data are presented as the fold change in gene expression normalized to an endogenous reference gene (β-actin, GAPDH) and relative to a control (CNKSR3-AIA, SPTBN2-AIA, IMPACT-AIA). For the control sample, ΔΔCt equals zero and 20 =1, so that the fold change in gene expression relative to the control =1 by definition (3). For the other samples, evaluation of 2ΔΔCt indicates the fold change in gene expression relative to the control. The fold differences in CNKSR3, SPTBN2, and IMPACT mRNA expression in each patient were also calculated by comparing their 2ΔΔCt.

Using the 2ΔΔCt method, the data are presented as the fold change in gene expression normalized to an endogenous reference gene (β-actin, GAPDH) and relative to a control (CNKSR3-AIA, SPTBN2-AIA, IMPACT-AIA). The fold differences in CNKSR3, SPTBN2, and IMPACT mRNA expression in each patient were also calculated by comparing their 2ΔΔCt.

Statistical methods

If distribution of the mRNA expression levels showed normality and equality in the variances in each group of AERD and ATA, then the classic 2-sample t-test was applied. If distribution of the mRNA expression levels showed normality and inequality in the variances in each group of AERD and ATA, then the Welch 2-sample t-test was used. If distribution of the mRNA expression levels did not show normality in either group of AERD and ATA, then the Mann-Whitney U-test was applied.

References

1.Niżankowska-Mogilnicka E, Bochenek G, Mastalerz L, Świerczyńska M, Picado C, Scadding G, Kowalski ML, Setkowicz M, Ring J, Brockow K, Bachert C, Wöhrl S, Dahlén B, Szczeklik A. AACI/GA2LEN guideline: aspirin provocation tests for diagnosis of aspirin hypersensitivity.Allergy 2007; 62:1111–8.

2. Chang Hun Soo, Park Jong-Sook, Jang An-Soo, Park Sung-Woo, Uh Soo-Taek, Kim Young Hoon, Park Choon-Sik. Diagnostic Value of Clinical Parameters in the Prediction of Aspirin-Exacerbated Respiratory Disease in Asthma. Allergy Asthma Immunol Res Posted online 2011 May 27 (in press).

3. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Methods. 2001 Dec; 25(4):402–8.