Octopamine and tyramine respectively regulate attractive and repulsive behavior in locust phase changes
Zongyuan Ma1,2†, Xiaojiao Guo1,2†, Hong Lei3, Ting Li1,2,
Shuguang Hao2, Le Kang1,2*
1Beijing Institutes of Life Sciences, Chinese Academy of Sciences, Beijing 100101, China
2State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, ChineseAcademy of Sciences, Beijing 100101, China
3Department of Neuroscience, The University of Arizona, Tucson, Arizona, USA
Supplementary Figures
Supplementary Figure S1
Figure S1. The migratory locustshowsbehavioral difference during phase change. (A) Solitarylocusts show behavioral shift toward gregarious phase after 32 h of crowding (Mann–Whitney U test,P< 0.001). (B) Gregarious locusts show a behavioral propensity for solitary phase after 1 h of isolation (Mann–Whitney U test,P< 0.001). Red lines indicate median P-sol values. Error bars represent ± SEM.Abbreviations: CS, crowding of solitary locusts; IG, isolation of gregarious locusts.
Supplementary Figure S2
Figure S2. The expression levels of house-keeping genes in brain tissues of migratory locusts during crowding and isolation.(A and B) The expression patterns of GAPDH over the time course of crowding (A) and isolation (B). (C and D) The expression patterns of Actinover the time course of crowding (C) or isolation (D). (E and F) The expression patterns of EF1aover the time course of crowding (E) or isolation (F). (G and H) The expression patterns of RP–49over the time course of crowding (G) or isolation (H). All data are presented as mean ± SEM. Abbreviations: S, solitary; G, gregarious; CS, crowding of solitary locusts; IG, isolation of gregarious locusts.
Supplementary Figure S3
Figure S3. The correlation ofthe expression levels of OARβ mRNA with the degree of preferences for gregarious volatiles or fresh air, respectively. (A) Relationships of the expression of OARβmRNA in the brains with the degree of preference for gregarious volatiles in crowding (n = 6 each). (B) Correlation of the expression of OARβmRNA in the brains with the degree of preference for fresh air (n = 6 each). Abbreviations: S, solitary locusts; CS, crowding of solitary locusts; G, gregarious locusts; IG, isolation of gregarious locusts.
SupplementaryFigure S4
Figure S4. The correlation of OA-OARαand TA-TAR signaling pathways with the degree of preferences for gregarious volatiles or fresh air, respectively. (A and B) Relationships of the amount of octopamine (A) and the expression level of OARα (B) in the brains with the degree of preference for gregarious volatiles in isolation (n = 6 each). (C and D) Correlations of the amount of tyramine (C) and the expression level of TAR(D) with the extent of the preference for gregarious volatiles in crowding (n = 6 each). Abbreviations: OA, octopamine; TA, tyramine;S, solitary locusts; CS, crowding of solitary locusts; G, gregarious locusts; IG, isolation of gregarious locusts.
Supplementary Figure S5
Figure S5.The expression levels of tyramine β hydroxylase during the crowding and isolation of migratory locusts. The alphabets indicates multiple comparisons after One-Way ANOVA with post hoc analysis (P < 0.05). Abbreviation: TβH, tyramine β hydroxylase.
Supplementary Figure S6
Figure S6. The correlation of the expression levels of TβH mRNA with the degree of preferences for gregarious volatiles or fresh air, respectively. (A) Relationships of the expression of TβH mRNA in the brains with the degree of preference for gregarious volatiles in crowding (n = 6 each). (B) Correlation of the expression of TβH mRNA in the brains with the degree of preference for fresh air (n = 6 each). Abbreviations:TβH, tyramine β hydroxylase; S, solitary locusts; CS, crowding of solitary locusts; G, gregarious locusts; IG, isolation of gregarious locusts.
Supplementary Figure S7
Figure S7. Spatial expression of the receptorsrelated to octopamine and tyramine in the brains of the fourth-stadium locusts. (A and B)Localization of OARαand its negative control in the brains. (C and D) Localization of TARand its negative control in the brains.Abbreviations:MB, mushroom body; AL, antennal lobe.
SupplementaryFigure S8
Figure S8.The expression levels of OARα and TAR after RNAi knockdown. (A) In gregarious locusts, the expression level of OARα is significantly reduced 3 d after brain injection of dsRNA (n = 8 each). (B) In solitary locusts, the expression level of TAR is significantly reduced 3 d after brain injection of dsRNA (n = 8 each). The asterisks outside the strip indicate the significance of treatments after Student’s t-test (**, P< 0.01; n.s., not significant).
Supplementary Figure S9. The phylogenetic tree of octopamine and tyramine receptors.
Figure S9. The phylogenetic tree of octopamine and tyramine receptors.The octopamine and tyramine receptor subtypes are confirmed by phylogenetic analysis. Consensus un–rooted tree were generated with 1000 bootstrap trials using neighbor joining method and presented with a cutoff value of 50. Red color indicates octopamine and tyramine receptors in the migratory locust. Abbreviations: Am, Apis mellifera; Dm, Drosophila melanogaster; Pa, Periplaneta americana; Ms, Manduca sexta; Sg, Schistocerca gregaria; Bm, Bombyx mori; Hv, Heliothis virescens; Ai, Agrotis ipsilon; Bm, Bophilus microplus; Lm, Locusta migratoria; Ag, Anopheles gambiae; NCBI, National Center for Biotechnology Information.NCBI Gene bank accession number used here were as follows: AmOAR1, CAD67999; DmOAMB, AAC17442; DmOAR1A, CAB38026; PaOAR1, AAP93817; BmOAR1, BAF33393; MsOAR, ABI33825; SgOARα, ADD91574; SgOARβ, ADD91575; BmOAR2, BAJ06526; DmOARβ1, CAI56428; DmOARβ2, CAI56430; DmOARβ3, NP_001034043; Amtyr1, CAB76374; Aityr/Oct, ACN12797; BmiTAR, CAA09335; HvTAR, CAA64864; Lm TAR (gcr1), CAA49268; BmTAR1, NP_001047504; DmTAR1 (Tyr–Dro), CAA38565; DmTAR2, AAK57748; BmTAR2, BAI52937; Dm(CG7431), NP_650652; Dm(CG16766), NP_650651; Amtyr-like, NP_001032395; Ag(GPRNNA4, XP_309588).
Supplementary Table
Table S1.The logistic regression model for behavioral classification in solitary and gregarious phase.Behavioral variables retained in the best-fitting logistic regression model are obtained from the fourth-stadium solitary and gregarious locusts. This table indicates the significance level of the individual model parameter for the behavioral discrimination of locusts. Abbreviations:TDM, total distance moved; FOM, frequency of movement; AI, attraction index.
Parameters in equation / β / S.E. / Wald / df / Sig. / Exp(β)TDM / -0.016 / 0.004 / 14.286 / 1 / 0 / 0.984
FOM / -0.172 / 0.073 / 5.494 / 1 / 0.019 / 0.842
AI / -0.005 / 0.001 / 20.571 / 1 / 0 / 0.995
Constant / 2.361 / 0.353 / 44.773 / 1 / 0 / 10.6
Table S2. Primer sequences for quantitative RT–PCR.
Genes / Forward primer / Reverse primerOARα / CGTATTCCTGTCGCACAAGCT / GCGAGCGAGACGATGAAGA
OARβ / CTGGTCGTCGACCTGGTCTT / GTTCAGCGTCGAGTTGAAGTAGC
TβH / CGATATTTGGGTCACAGCT / TTCAGTAGCCTGATTTCCT
TAR / CTACACCATCTTCAACCTCG / TTTCCTGATAAAGTTTCGCA
GAPDH / GTCTGATGACAACAGTGCAT / GTCCATCACGCCACAACTTTC
Actin / AATTACCATTGGTAACGAGCGATT / TGCTTCCATACCCAGGAATGA
EF1a / GATGCTCCAGGCCACAGAGA / TGCACAGTCGGCCTGTGAT
RP–49 / CGCTACAAGAAGCTTAAGAGGTCAT / CCTACGGCGCACTCTGTTG
Table S3. Primer sequences for RNAi.
Genes / Forward primer / Reverse primerOARα / CATCGTGGGCGGCTTCATC / GAGACGGGAGTTACAGACAC
TAR / GTCTCTTTCGTTTCGGGCTT / CAGTCTCCCAATCTGCCTCA
1