Supplementary Material
Amplicon library construction: We constructed amplicon libraries for bacterial 16S v3 through v5 domains (Bv3v5) and v4 through v6 domains (Bv6v4). The adapter and 16S-specific sequences are shown in Table 1. Each primer contains either of the A (5'-CGTATCGCCTCCCTCGCGCCATCAG-3') or B (5'-CTATGCGCCTTGCCAGCCCGCT-CAG-3') amplicon adapters followed by a 5 nt multiplex identifier (MID; barcode) and ends with the 16S specific sequence. Bv6v4 amplicons are amplified with a pair of degenerate primers (1064R and 518F) and the MID is present in both primers. Bv3v5 amplicons are generated using a pool of two forward and three reverse primers and the MID is present in all five oligonucleotides. All MIDs differ by at least two bases and contain no homopolymers. The individual oligos are mixed in equal proportions to create F/R primer pools. The polymerase chain reaction mixture contains 1X Platinum HiFi Taq polymerase buffer, 1.6 units Platinum HiFi polymerase (Life Technologies, Carlsbad CA), 3.7 mM MgSO4, 200 uM dNTPs (PurePeak polymerization mix, ThermoFisher, E. Providence RI), and 50 nM combined primers. 5-25 ng of sample DNA is added to a master mix to a final volume of 100 ul and this is divided into three replicate 33 ul reactions. We include a no-template negative control for each MID. Conditions are an initial denaturation at 94oC for 3 minutes; 30 cycles of 94oC for 30 seconds, 60oC for 45 seconds, and 72oC for 1 minute; and a final extension at 72oC for 2 minutes using an Applied Biosystems 2720 or 9700 cycler (Life Technologies). The three replicates are pooled and we check 1 ul of the pool and the negative control on a LabChip GX (Caliper, Hopkinton MA). We clean the reaction and remove products under 300 bp using Ampure beads at 0.75X volume (Beckman Coulter, Brea CA). The final products are resuspended in 100 ul of 10mM Tris-EDTA, quantitated using PicoGreen Quant-IT assay (LifeTechnologies), and assayed on a Bionanalyzer DNA1000 chip (Agilent Technologies, Santa Clara, CA). We pool up to 40 amplicon libraries prior to emulsion PCR. The emPCR, enrichment, and sequencing are done according to current Roche Titanium amplicon sequencing protocols (Lib-A emPCR reagents, XLR sequencing reagents, two region PicoTitre plate). Image processing and signal calling are done using the Roche amplicon-processing pipeline (version 2.53 for these datasets) with recursive phase correction algorithm to maximize the number of long reads.
Table S1. Primers and probes used in the study.
Name / Sequence (5'-3') / Reference/CommentFISH / Eub I / GCTGCCTCCCGTAGGAGT / (Daims et al., 1999)
ibid
ibid
Eub II / GCAGCCACCCGTAGGTGT
Eub III / GTCTGCCACCCGTAGGTGT
Arc 915 / GTGCTCCCCCGCCAATTC / (Stahl and Amann, 1991)
Arc 344 / TCGCGCCTGCTGCICCCCGT / (Raskin et al., 1994)
Aceto 125 / TCCAAAGGGTAGGTTACCCA / (Gaidos et al., 2009)
ibid
ibid
ibid
Ssprill 572 / TTCCAGCCTACGCATCCTTT
Scurvum 731 / GTATCATCCCAGCAGATCGC
Palud 672 / CCGCTACACAACACATTCCG
Non 338 / ACTCCTACGGGAGGCAGC / (Amann et al., 1990)
clone / 23FLP (A) / GCGGATCCGCGGCCGCTGCAGAYC-TGGTYGATYCTGCC / (Barns et al., 1994)
27F (B) / AGAGTTTGATCCTGGCTCAG / (Lane, 1991)
751F (A) / CCGACGGTGAGRGRYGAA / (Baker et al., 2003)
805R (U) / GACTACCCGGGTATCTAATCC / (Amann et al., 1995)
976R (A) / YCCGGCGTTGAMTCCAATT / (Baker et al., 2003)
1391R (B) / GACGGGCGGTGTGTRCA / (Barns et al., 1994)
1406R (A) / ACGGGCGGTGWGTRCAA / (Baker et al., 2003)
1544R (B) / CCCGGGATCCAAGCTTAGAAAGGA / (Lane, 1991)
pyrosequencing / v3-v5 / 341F2 / CCTACGGGNGGCWGCAG / this work
341F3 / TCTACGGAAGGCTGCAG / this work
785F-a / GGATTAGATACCC / informatics landmark only
926R1 / CCGTCAATTCNTTTRAGT / this work
926R3 / CCGTCAATTTCTTTGAGT / this work
926R4 / CCGTCTATTCCTTTGANT / this work
v4-v6 / 518F / CCAGCAGCYGCGGTAAN / this work
565F-a / TGGGCGTAAAG / informatics landmark only
1064R / CGACRRCCATGCANCACCT / (Huber et al., 2007)
v6 / 967F / CAACGCGAAGAACCTTACC / (Huber et al., 2007)
1046R / CGACAGCCATGCANCACCT / (Huber et al., 2007)
B = Bacterial domain A=Archaeal domain U=Universal
Table S2. Statistics of pyrosequencing libraries
Sample / Depth1(meters) / Reads2 / Filtered reads3 / Unique sequences4 / Median
length
v3-v5 / A1 / 284 / 21034 / 21013 / 2682 / 416
A2 / 331 / 20549 / 20519 / 2774 / 415
A3 / 379 / 21975 / 21946 / 3221 / 415
B1 / 284 / 22059 / 22052 / 3366 / 416
B2 / 336 / 21508 / 21505 / 3290 / 416
B3 / 377 / 20798 / 20714 / 3094 / 416
B4 / 388 / 22970 / 22837 / 3243 / 415
Total lake / --- / 150893 / 150586 / 51135 / 416
Outlet / 0 / 19646 / 19644 / 2950 / 415
v4-v6 / A1 / 284 / 24548 / 24420 / 2814 / 483
A2 / 331 / 23937 / 23518 / 4543 / 484
A3 / 379 / 18882 / 18487 / 2687 / 484
B1 / 284 / 18534 / 18402 / 1744 / 483
B2 / 336 / 19392 / 19364 / 2349 / 478
B3 / 377 / 21294 / 20801 / 2112 / 479
B4 / 388 / 23702 / 22957 / 2524 / 484
Total lake / --- / 150289 / 147979 / 69729 / 484
Outlet / 0 / 17916 / 17838 / 4931 / 486
v6 / B1 / 284 / 12197 / 10532 / 1180 / 98
B3 / 377 / 8143 / 6978 / 775 / 98
B4 / 388 / 13947 / 11628 / 1308 / 97
Kverkfjallalón / 4 / 9872 / 8030 / 1089 / 97
Outlet / 0 / 14910 / 13620 / 2677 / 100
West lake / 412 / 9352 / 8984 / 1179 / 60
1Below ice surface
2After VAMPS pipeline processing
3After removal of chimeras
4After pre-clustering step (up to 2 differences for v3-v5 and 4 for v4-v6)
S-1
Table S3. East Skaftárketill lake geochemistry (concentrations in ppm)
Sample / pHT(ºC) / CO2 / SiO2 / Na / K / Ca / Mg / Fe / Al / Sr / B / F / Cl / SO4 / H2S
A1 / 5.75 (8.8) / 93.83 / 99.91 / 30.22 / 3.41 / 3.43 / 0.241 / 0.239 / 0.082 / 0.0064 / 0.515 / 0.113 / 10.45 / 0.30 / 15.90
A2 / 5.81 (11.6) / 82.03 / 110.18 / 30.14 / 3.44 / 3.47 / 0.257 / 0.185 / 0.133 / 0.0059 / 0.515 / 0.111 / 10.41 / 2.74 / 19.99
A3 / 5.45 (5.6) / 122.49 / 101.74 / 30.65 / 3.46 / 3.50 / 0.250 / 0.262 / 0.093 / 0.0063 / 0.530 / 0.122 / 12.28 / 4.71 / 11.54
B1 / 5.19 (12.9) / 106.28 / 99.61 / 30.04 / 3.39 / 3.46 / 0.245 / 0.161 / 0.083 / 0.0049 / 0.518 / 0.107 / 10.16 / 0.29 / 14.36
B2 / 5.25 (14.2) / 121.47 / 98.32 / 29.75 / 3.35 / 3.42 / 0.247 / 0.235 / 0.102 / 0.0049 / 0.513 / 0.106 / 10.16 / 1.08 / 10.30
B3 / 5.22 (13.6) / 96.16 / 97.94 / 29.60 / 3.45 / 3.45 / 0.239 / 0.179 / 0.077 / 0.0053 / 0.510 / 0.106 / 9.97 / 1.03 / 15.04
B4 / 5.21 (8.9) / 112.89 / 99.23 / 30.44 / 3.24 / 4.74 / 0.305 / 0.332 / 0.086 / 0.0089 / 0.525 / 0.114 / 10.66 / 1.43 / 25.50
Mean / --- / 105.02 / 99.56 / 30.12 / 3.38 / 3.64 / 0.255 / 0.228 / 0.094 / 0.0061 / 0.517 / 0.111 / 10.58 / 1.66 / 16.09
% Var / --- / 14.4 / 1.3 / 1.2 / 2.2 / 13.4 / 9.0 / 26.0 / 20.4 / 23.2 / 1.0 / 5.1 / 7.4 / 95.4 / 32.3
S-1
Table S4. Growth results for 3°C enrichments
Aerobic / AnaerobicSample / 162-1 / WO2 / A-J / C-J / YPS / Toga / WN2
A1 / +°· / +° / +° / - / +° / +° / +
A2 / + / - / - / - / +° / + / +°·
A3 / - / +° / +° / +· / +° / +°· / +*
B1 / +°· / - / + / - / +° / - / +·
B2 / +··Â / +° / + / - / +· / +·* / +··
B3 / - / + / - / - / +°· / + / +°·
B4 / + / + / - / +· / +°· / +° / +°·
borehole1 / - / - / - / - / - / - / -
jökulhlaup / +· / + / +° / +· / +°·· / +°· / +·
Kverkfjallalón / +······· / + / + / + / + / + / +
1Negative control
ÂR2A medium used instead
°Denotes strain isolated by serial dilution in liquid cultures at 3°C.
·Denotes strain isolated as above and ribotyped.
*Denotes clone library constructed from enrichment.
Table S5. OTUs from 60°and 80°C enrichments of east Skaftárketill lake sample B4
1 / EU299434.1 / Uncultured Pedomicrobium clone GASP KC1W2 (96) / soil
1 / AY684097.1 / Uncultured Thermoanaerobacteriaceae clone MRE50b20 (85) / hot spring
38 / AF255600.1 / Uncultured bacterium SRI-280 (99) / Iceland hot spring
3 / AF2555602.1 / Nitrospira sp. SRI-237 (98) / Iceland hot spring
5 / EY409943.1 / Caloramator australicus strain KCTC 5601 (98) / Great Artesian Basin of Australia
1 / X97693.1 / Pedomicrobium australicum (96) / Great Artesian Basin of Australia
1 / AP009389.1 / Pelotomaculum thermopropionicum SI (96) / anaerobic sludge reactor
1 / FJ748765.1 / Thermoanaerobacter sp. RH0806 (80) / hot spring
S-1
Table S6. Estimated community richness and evenness from pyrosequence libraries (95% confidence intervals)
Locus / Sample / Sobs / ACE / Chao1 / Shannon H / Simpson D / ACE*v3-v5 (3%) / A1 / 63 / 794 (565,1127) / 228 (130,470) / 1.15 (1.14,1.16) / 0.379 (0.375,0.382) / 73 ± 24
A2 / 56 / 762 (564,1035) / 223 (117,513) / 1.00 (0.99,1.02) / 0.491 (0.485,0.498) / 74 ± 28
A3 / 63 / 340 (253,466) / 230 (124,520) / 1.14 (1.12,1.15) / 0.427 (0.422,0.431) / 72 ± 17
B1 / 74 / 627 (493,804) / 215 (135,401) / 1.49 (1.48,1.50) / 0.287 (0.284,0.291) / 89 ± 22
B2 / 64 / 192 (144,267) / 126 (88,222) / 1.44 (1.42,1.45) / 0.310 (0.306,0.313) / 69 ± 13
B3 / 96 / 590 (463,763) / 273 (179,475) / 1.51 (1.49,1.52) / 0.305 (0.301,0.309) / 107 ± 22
B4 / 92 / 382 (282,535) / 223 (156,358) / 1.53 (1.51,1.54) / 0.285 (0.282,0.288) / 99 ± 18
summed / 321 / 2384 (2053,2777) / 1140 (857,1572) / 1.39 (1.38,1.40) / 0.325 (0.324,0.326) / ND
hlaup1 / 156 / 330 (253,468) / 534 (445,649) / 0.38 (0.36,0.40) / 0.901 (0.895,0.907) / ND
v4-v6 (3%) / A1 / 329 / 2338 (2041,2686) / 1183 (889,1632) / 1.48 (1.46,1.50) / 0.325 (0.322,0.329) / 356 ± 32
A2 / 575 / 3029 (2721,3381) / 1583 (1323,1932) / 1.64 (1.62,1.66) / 0.337 (0.332,0.341) / 616 ± 34
A3 / 400 / 2638 (2326,3001) / 1447 (1113,1938) / 1.76 (1.74,1.79) / 0.285 (0.281,0.289) / 421 ± 28
B1 / 208 / 1972 (1685,2314) / 747 (537,1118) / 1.53 (1.51,1.55) / 0.333 (0.328,0.338) / 228 ± 31
B2 / 267 / 1555 (1330,1827) / 759 (584,1029) / 1.59 (1.57,1.61) / 0.324 (0.319,0.330) / 283 ± 24
B3 / 337 / 2630 (2278,3046) / 1150 (881,1552) / 1.72 (1.70,1.74) / 0.316 (0.311,0.321) / 363 ± 31
B4 / 410 / 2835 (2506,3217) / 1378 (1081,1808) / 1.79 (1.77,1.81) / 0.263 (0.260,0.267) / 448 ± 40
summed / 1500 / 5695 (5352,6068) / 3255 (2960,3608) / 1.76 (1.75,1.77) / 0.283 (0.282,0.285) / ND
hlaup1 / 725 / 2038 (1863,2240) / 1523 (1333,1771) / 2.02 (1.98,2.06) / 0.462 (0.453,0.471) / ND
v6 (10%) / B1 / 82 / 189 (152,245) / 121 (99,173) / 1.25 (1.23,1.28) / 0.434 (0.426,0.443) / ND
B3 / 73 / 224 (174,299) / 137 (100,222) / 1.36 (1.33,1.40) / 0.376 (0.369,0.385) / ND
B4 / 90 / 294 (230,387) / 184 (133,295) / 1.09 (1.07,1.12) / 0.485 (0.477,0.493) / ND
summed / 154 / 364 (304,449) / 253 (208,335) / 1.24 (1.21,1.25) / 0.437 (0.432,0.442) / ND
hlaup1 / 445 / 834 (760,926) / 703 (619,826) / 3.13 (3.09,3.16) / 0.156 (0.151,0.162) / ND
Kverk2 / 67 / 200 (155,269) / 110 (85,167) / 0.69 (0.65,0.72) / 0.762 (0.750,0.774) / ND
west3 / 402 / 1467 (1293,1674) / 983 (807,1237) / 1.85 (1.80,1.90) / 0.422 (0.411,0.434) / ND
1jökulhlaup sample 2Kverkfjallalón subaerial lake 3west Skaftárketill subglacial lake
S-1
Supplementary Figures
Figure S1. Temperature profiles in the west (grey) and east (black) Skaftárkatlar lakes with depths reported relative to the ice-lake interface. The east lake is shallower than the west lake at the borehole locations. Dotted and solid lines are for profiles beneath boreholes A and B, respectively, in the east lake. The dashed line is the maximum density temperature of pure water. Circles mark sampling depths, with temperatures chosen to illustrate from which borehole the samples were obtained.
Figure S2. Concentrations of major dissolved solids in the west (1 sample) and east (7 samples) Skaftárkatlar lakes. Two major constituents, CO2 (averaging 1300 and 105 ppm in west and mean east lakes, respectively) and H2S (averaging 37 and 16 ppm) are not shown because they may vary due to degassing during sample retrieval. The dendogram was constructed by single linkage of euclidian distances between samples.
Figure S3 Unrooted ARB tree of isolates from east Skaftárketill lake, the Kverkfjallalón subaerial lake, and a sample of a jökulhlaup in the Skaftá river. For the Skaftárketill isolates, the sample name and enrichment conditions are suffixed.
Figure S4. Rank abundance of OTUs (3% clustering criterion) in v4-v6 and v3-v5 pyrosequencing libraries from east lake samples. The dashed line is an approximation to the v4-v6 trends that is reproduced in the v3-v5 plot to aid comparison.
Figure S5. Rarefaction curves for v3-v5 and v4-v6 pyrosequence libraries generated from samples of the east Skaftárkatlar lake. Note the log-log scale. OTUs are defined by a 3% average difference cutoff.
Figure S6. Fractional abundance of v3-v5 and v4-v6 reads assigned to the same taxonomic groups. Squares are assignments of reads based on common taxonomic affiliations at the genus level. Diamonds are assignments based on a clustering of representative sequences from independently determined v3-v5 and v4-v6 OTUs (cutoff of 11%). The dashed line is equality, and the dot-dashed lines are 2-sigma standard deviations due to Poisson statistics alone.