Supplementary Table S1 PCR primers for COI amplification. F, forward primer; F int, forward primer for 3'-half; R, reverse primer; R int, reverse primer for 5' half

# / Position / Sequence (5'-3') / Remarks
1 / F / GCTGACTATNTTCNACNAACCACAAAG
2 / F / TCTACCAACCACAAAGATATCGG
3 / R int / TAGCATTGTTATTCCTCCGGCTA
4 / R int / TARCATNGTNATTCCNCCNGCTA / modified from #3
5 / R int / TARCATTGTTATTCCBCCDGCTA / modified from #3
6-8 / F int / reverse-complements of #3-5
9 / R / TCCTAGAAANTGTTGNGGGAAGAAAG
10 / R / TCCTARAAANTGTTGNGGGAARAANG / modified from #9
11 / R / TCCTARAAARTGTTGDGGGAARAASG / modified from #9

Supplementary Table S2 Overview of molecular dataset and GenBank accession numbers for new sequences. Previously published sequences indicated by "X". If not stated otherwise, sequences from Dohrmann et al. (2008, 2009). *, fragments did not overlap, leaving an internal gap.; –, missing data. Previously unsampled species in bold

Family / Species / 18S 5' / 18S 3' / 28S 5' / 28S 3' / 16S / COI 5' / COI 3'
Rossellidae / Rossella nuda / X / X / X / FR848919 / –
Rossella racovitzae / X / X / X / –
Rossella sp. / – / – / X / X / FR848920 / –
Rossella nodastrella / X / X / X / FR848921*
Rossellinae n. gen. n. sp. / X / X / X / –
Crateromorpha meyeri / X / X / X / FR848923 / –
Bathydorus spinosus / X / X / X / FR848924
Bathydorus n. sp. / X / X / X / FR848925
Aulosaccus mitsukurii / X* / X / X / FR848922
Acanthascus dawsoni / Xa / Xb / X / FR848918*
Caulophacus valdiviae / X / X / X / FR848929
Caulophacus weddelli / X / X / X / FR848928
Caulophacus arcticus / X / X / X / FR848930 / –
Caulophacella tenuis / X / X / X / FR848927
Lophocalyx profundumf / X / X / X / FR848926 / –
Sympagella nux / FR848912 / FR848913 / Xc / Xc
Leucopsacidae / Leucopsacus sp. / X / X / X / FR848931 / –
Oopsacas minuta / Xd / FR848914 / FR848915 / FR848932
incertae sedis / Clathrochone clathroclada / – / – / X / X / FR848933
Euplectellidae / Acoelocalyx brucei / X / X / X / – / FR848938
Malacosaccus coatsi / X / X / X / – / FR848937
Euplectella sp. 1 / X / X / X / FR848935
Euplectella sp. 2 / X / X / X / –
Docosaccus n. sp. / X / X / X / FR848934
Walteria leuckarti / X / X / X / FR848939
Hertwigia sp. / X / X / X / FR848940
Regadrella sp. / – / FR848916 / FR848917 / FR848936
Saccocalyx sp. / – / – / X / X / – / –
Bolosoma n. sp. / X / X / X / FR848942
Rhabdopectella tintinnus / X / X / X / FR848941
Dactylocalycidae / Iphiteon panicea / X / X / X / Xc
Aphrocallistidae / Aphrocallistes vastus / X / X / Xe / Xe
Aphrocallistes beatrix / X / X / X / FR848902
Heterochone calyx / X / X / X / FR848901
Heterochone sp. / X / X / X / FR848900
Farreidae / Farrea sp. / X / X / X / FR848906*
Aspidoscopulia n. sp. 1 / FR846203 / – / FR846204 / FR846205 / FR848903
Aspidoscopulia n. sp. 2 / FR846206 / – / FR846207 / FR846208 / FR848904
Lonchiphora antarctica / FR846209 / – / FR846210 / FR846211 / – / FR848905
Sarostegia oculata / FR846212 / FR846213 / FR846214 / FR848907*
Euretidae / n. gen. n. sp. / X / X / X / FR848908
Tretodictyidae / Tretodictyum tubulosum / X / X / X / FR848910
Hexactinella carolinensis / X / – / X / X / FR848911
Psilocalyx wilsoni / FR846215 / FR846216 / FR846217 / FR848909 / –
Hyalonematidae / Hyalonema sp. 1 / – / – / X / X / – / –
Hyalonema sp. 3 / X / X / X / FR848947*
Hyalonema sp. 4 / X / X / X / FR848948 / –
Pheronematidae / Pheronema sp. / – / – / X / X / FR848943*
Semperella schulzei / X / X / X / FR848945*
Sericolophus hawaiicus / X / X / X / FR848944 / –

aCollins (1998); bMedina et al. (2001); cHaen et al. (2007); dBorchiellini et al. (2001); eRosengarten et al. (2008); f "Lophocalyx n. sp." in Dohrmann et al. (2008, 2009); this species was recently described (Janussen & Reiswig, 2009)

Supplementary Table S2 References

Borchiellini, C., M. Manuel, E. Alivon, N. Boury-Esnault, J. Vacelet & Y. Le Parco, 2001. Sponge paraphyly and the origin of Metazoa. Journal of Evolutionary Biology 14: 171–179.

Collins, A. G., 1998. Evaluating multiple alternative hypotheses for the origin of Bilateria: an analysis of 18S rRNA molecular evidence. Proceedings of the National Academy of Sciences of the United States of America 95: 15458–15463.

Haen, K. M., B. F. Lang, S. A. Pomponi & D. V. Lavrov, 2007. Glass sponges and bilaterian animals share derived mitochondrial genomic features: a common ancestry or parallel evolution? Molecular Biology and Evolution 24: 1518–1527.

Janussen, D. & H. M. Reiswig, 2009. Hexactinellida (Porifera) from the ANDEEP III expedition to the Weddell Sea, Antarctica. Zootaxa 2136:1–20.

Medina, M., A. G. Collins, J. D. Silberman & M. L. Sogin, 2001. Evaluating hypotheses of basal animal phylogeny using complete sequences of large and small subunit rRNA. Proceedings of the National Academy of Sciences of the United States of America 98: 9707–9712.

Rosengarten, R. D., E. A. Sperling, M. A. Moreno, S. P. Leys & S. L. Dellaporta, 2008. The mitochondrial genome of the hexactinellid sponge Aphrocallistes vastus: evidence for programmed translational frameshifting. BMC Genomics 9: 33.