Expanding the Body Mass Range: Associations Between BMR and Tissue Morphology in Wildtype

Expanding the body mass range: associations between BMR and tissue morphology in wildtype and mutant dwarf mice (David mice)

Electronic supplementary material

S1:

WT and David phenotypes at the age of 12 weeks.

S2:

ENU Mutagenesis and breeding

The David mutant mouse line was generated and identified in a recessive ENU mutagenesis screen at Ingenium Pharmaceuticals AG. C3HeB/FeJ males (G0) were subjected to fractionated injections of ENU as described elsewhere (Russell et al. 1982; Hitotsumachi et al. 1985). For generation of G1 offspring G0 males were mated to C3HeB/FeJ females. The screen for recessive mutations involved two more generations of breeding: from G1 founder males, G2 offspring were raised, half of which were heterozygous for newly induced mutations; backcrossing G2 to the G1-founder male or intercrossing the G2 was then carried out to identify recessive mutant phenotypes among the G3 offspring. G3-offspring mice were phenotypically screened for dysmorphological malformations.

Chromosomal mapping

Dwarfism was used as the primary marker for chromosomal mapping of the David locus. Homozygous C3HeB/FeJ-David/David individuals were outcrossed to BALB/c genetic background and heterozygous F1 hybrids were intercrossed to obtain F2 individuals. The initial chromosomal mapping of the David mutation to chromosome 4 was performed on 24 affected F2*(C3HeB/FeJ x BALB/c) individuals: Comparable DNA amounts were pooled and subjected to sequencing of 68 SNPs equally distributed over the genome. Sequence traces of SNPs with closer linkage to the David mutation display basecallings similar to the C3H control, whereas uncoupled SNPs on average display the heterozygous situation, i.e. peaks of equal intensity diagnostic for both, C3HeB/FeJ and BALB/c alleles. Higher resolution mapping was performed by haplotype analysis on the single mouse level of a total number of 107 F2 animals using fluorescent-labeled simple-sequence-length polymorphisms (SSLP) and single-nucleotide polymorphisms (SNP) markers. PCR products for genotyping and sequencing were separated on ABI3700 automated sequencing devices. SSLP markers were analysed using the ABI Genotyper program; SNPs were analysed by BigDye terminator (v3.0) sequencing. The David mutation is located within a 23 Mb region flanked by the informative microsatellite marker D4Mit214 on Mb position 46 (proximal) and the newly established polymorphic marker D4Ing26 (D4Ing26sense, TCCTCTTCCACATCTTC; antisense, AATACTGGTCGCAAACCCTAGC; C3H 217bp; BALB/c, 221bp) on Mb position 69 (distal) (

Reference List

1. Hitotsumachi S, Carpenter DA, Russell WL (1985) Dose-repetition increases the mutagenic effectiveness of N-ethyl-N-nitrosourea in mouse spermatogonia. Proc.Natl.Acad.Sci.U.S.A 82: 6619-6621

2. Russell WL, Hunsicker PR, Carpenter DA, Cornett CV, Guinn GM (1982) Effect of dose fractionation on the ethylnitrosourea induction of specific-locus mutations in mouse spermatogonia. Proc.Natl.Acad.Sci.U.S.A 79: 3592-3593

1

30.10.2018