Supplementary Table 1List of primers used in this study.

Primername / Primer sequence (5ˊ-3ˊ) / Function
COR15A-F / GCCAGAAAACTCAGTTCGTCG / Semi-quantitative and real-time quantitative PCR analysis of COR15Agene
COR15A-R / ATACGCCGCAGCTTTCTCAGC
TIP41-like-F / GAAATTCAGGAGCAAGCCGTCTCAG / Semi-quantitative PCR analysis of TIP41-like gene
TIP41-like-R / ATCAACTCTCAGCCAAAATCGCAAG
rTIP41-like-F / GTATGAAGATGAACTGGCTGACAAT / Real-time quantitative PCR analysis of TIP41-like gene
rTIP41-like-R / ATCAACTCTCAGCCAAAATCGCAAG
rLhcb1-F / TGCAAAGACTTTGTATGATTTGTC / Real-time quantitative PCR analysis of LHCB1 gene
rLhcb1-R / GAACCCAAGAACTGAAAATCCA
Pcor15a-F / CGCGGATCCCTTCGGAACAACAACAAGAGT / Amplification of COR15A promoter
Pcor15a-R / CATGCCATGGGAGAGAGATCTTTAAGATGT
OEcor15a-F / CATGCCATGGCGATGTCTTTCTCAGGAGCT / Amplification of COR15A coding region
OEcor15a-R / GGGTAACCCTACTTTGTGGCATCCTTAGCC

Supplementary Table 2 The putative cis-elements involved in light responsivenesswas analyzed using MatInspectorsoftware.

Matrix family / Detailed family information / Matrix / Detailed matrix information / Sequence / Start position / End position / Anchor position / Strand / Matrix sim
P$PREM / Motifs of plastid response elements / P$MGPROTORE.01 / Promoter elements involved in Mg-Proto (Mg-protoporphyrin IX) and light-mediated induction / gcagCGACagatagagagagttaaaaaggaa / 117 / 147 / 132 / + / 0.808
P$LREM / Light responsive element motif, not modulated by different light qualities / P$RAP22.01 / RAP2.2, involved in carotenoid and tocopherol biosynthesis and in the expression of photosynthesis- related genes / agATCTattat / 240 / 250 / 245 / - / 0.853
P$IBOX / Plant I-Box sites / P$IBOX.01 / I-Box in rbcs genes and other light-regulated genes / gttgtGAAAagattgtc / 512 / 528 / 520 / - / 0.812
P$PREM / Motifs of plastid response elements / P$MGPROTORE.01 / Promoter elements involved in Mg-Proto (Mg-protoporphyrin IX) and light-mediated induction / aaacCGACaaggttgcaagcctaaatgtaaa / 701 / 731 / 716 / - / 0.774
P$IBOX / Plant I-Box sites / P$IBOX.01 / I-Box in rbcs genes and other light-regulated genes / aaaccGACAaggttgca / 715 / 731 / 723 / - / 0.815
P$LREM / Light responsive element motif, not modulated by different light qualities / P$RAP22.01 / RAP2.2, involved in carotenoid and tocopherol biosynthesis and in the expression of photosynthesis- related genes / aaATCTaccaa / 747 / 757 / 752 / - / 0.873
P$LREM / Light responsive element motif, not modulated by different light qualities / P$RAP22.01 / RAP2.2, involved in carotenoid and tocopherol biosynthesis and in the expression of photosynthesis- related genes / aaATCTagaaa / 893 / 903 / 898 / + / 0.912
P$GAPB / GAP-Box (light response elements) / P$GAP.01 / Cis-element in the GAPDH promoters conferring light inducibility / acgtATTAagagtaa / 1065 / 1079 / 1072 / - / 0.887
P$LREM / Light responsive element motif, not modulated by different light qualities / P$RAP22.01 / RAP2.2, involved in carotenoid and tocopherol biosynthesis and in the expression of photosynthesis- related genes / cgATCTataaa / 1106 / 1116 / 1111 / + / 0.893
P$LREM / Light responsive element motif, not modulated by different light qualities / P$RAP22.01 / RAP2.2, involved in carotenoid and tocopherol biosynthesis and in the expression of photosynthesis- related genes / gaATCTaatct / 1130 / 1140 / 1135 / - / 0.902
P$LREM / Light responsive element motif, not modulated by different light qualities / P$RAP22.01 / RAP2.2, involved in carotenoid and tocopherol biosynthesis and in the expression of photosynthesis- related genes / tcATCTaaaaa / 1158 / 1168 / 1163 / + / 0.975