Protocols #1-6 Materials and Equipment List:
Chemicals
· Ethanol (96–100%) and 70%
· Agarose powder
· 1x TBE Buffer
· GelStarTM fluorescent stain (or other nucleic acid gel stain)
· Loading dye
· Sterile water
· FishF1 and FishR1 oligonucleotide primers (sequences listed in Protocol #2)
Materials
· Scalpel
· Forceps
· Pipettes
· Pipet tips (including filtered pipet tips for PCR)
· Microcentrifuge tubes (1.5 ml or 2 ml)
· PCR tubes
· Plastic weigh boats
· 250mL Erlenmeyer flask
· 100mL graduated cylinder
· Rubber hot hands for handling hot glassware
Kits
· DNeasy Blood and Tissue Kit (supplied by QIAGEN Inc., product # 69504)
· HotStar Taq Master Mix Kit (supplied by QIAGEN Inc., product # 203443)
· MinElute PCR Purification Kit (supplied by Qiagen Inc. product # 28004)
Equipment/Instruments
· Bunsen burner
· Thermomixer or water bath
· Scale/balance
· Vortexer
· Microcentrifuge
· Microwave
· Gel box & power supply
· Gel mold & gel comb
· PCR machine
· NanoDrop instrument
· Computer with Internet access
Protocol #1: DNA Extraction from Fish Tissue
This protocol is designed for isolating genomic DNA from fish tissue. It requires spin columns and reagents from the DNeasy Blood and Tissue Kit (supplied by QIAGEN Inc., product # 69504). Alternative DNA extraction kits can be substituted after step 2.
Materials/Equipment
· DNeasy Blood and Tissue Kit (supplied by QIAGEN Inc., product # 69504)
· Scalpel
· Forceps
· Pipettes and pipet tips
· Microcentrifuge tubes (1.5 ml or 2 ml)
· Plastic weigh boats
· Ethanol (96–100%) and 70%
· Bunsen burner
· Thermomixer or water bath
· Scale/balance
· Vortexer
· Microcentrifuge
Before starting the procedure
· Obtain fish samples and bring them to room temperature (15-25°C)
· Pre-heat water bath or thermomixer to 56°C for step 5
· Ensure all reagents have been diluted with ethanol according to kit instructions
Procedure
1. Cut and weigh 25-35mg of fish tissue.
Use a 70% ethanol bath and Bunsen burner to flame sterilize forceps and scalpel before use and between samples. Cut out a small (~corn kernel sized) piece of tissue and weigh.
2. Cut tissue sample into small pieces and place in a labeled microcentrifuge tube.
Be sure the sample is at the bottom of the tube.
Note: Cutting the sample into small pieces allows for more efficient tissue lysis
3. Add 180 μl Buffer ATL.
4. Add 20 μl Proteinase K.
Mix thoroughly by vortexing for 5-10 seconds.
Note: The detergent in buffer ATL and the Proteinase K will dissolve the cell membrane and release the DNA into solution.
5. Incubate at 56°C for 1.5-2.5 hrs (or until tissue is completely lysed), vortexing occasionally
After incubation is complete, vortex 15 sec before moving on to step 6.
6. Add 200 μl Buffer AL to sample. Mix thoroughly by vortexing.
7. Add 200 μl ethanol (96-100%). Mix again thoroughly by vortexing.
It is essential Buffer AL and ethanol are mixed immediately to yield a homogeneous mixture. A white precipitate may form on addition of Buffer AL and ethanol. This precipitate does not interfere with the DNA extraction procedure.
8. Pipet the mixture from step 7 into a DNeasy Mini spin column placed in a 2 mL collection tube.
Do not disturb the spin column’s membrane with the pipette tip, as this may adversely affect the ability of DNA to bind.
9. Centrifuge at 8000 rpm for 1 minute in a microcentrifuge.
For all centrifugation steps, be sure that samples are balanced.
Note: During this spin, DNA will bind to the silica membrane and the cellular debris will wash through.
10. Discard flow-through liquid and the collection tube. Place the DNeasy Mini spin column in a new 2 mL collection tube.
11. Add 500 μl Buffer AW1. Centrifuge at 8,000 rpm for 1 minute.
Note: In this wash step, non-DNA impurities will flow through the column.
12. Discard flow-through liquid and the collection tube. Place the DNeasy Mini spin column in a new 2 mL collection tube.
13. Add 500 μl Buffer AW2. Centrifuge at 14,000 rpm for 3 min.
Note: The longer spin time ensures that all ethanol flows through the column and the membrane dries.
14. Discard flow-through and collection tube. Place the DNeasy spin column in a clean, labeled microcentrifuge tube.
15. Pipet 200 μl Buffer AE directly onto the DNeasy membrane and incubate at room temperature for 1 min.
16. Centrifuge at 8,000 rpm for 1 minute to elute the DNA. Do not discard the flow-through!
Note: This step elutes DNA bound to membrane of the column into the microcentrifuge tube.
17. Label and store the microcentrifuge tube containing the extracted DNA. Store in the refrigerator (4°C) or for longer-term storage in the freezer (-20°C).
Protocol #1.1: Practice Gel Loading
If students have never performed gel electrophoresis, it may be useful to practice sample loading before loading fish DNA. This protocol is designed to give students a chance to practice loading gels using a mixture of water and loading dye. Either the instructor or the students can make the practice gels and loading solutions. No fluorescent stain is added to the liquid agarose since the gel will not be run or imaged.
Materials/Equipment
· Pipettes and pipet tips
· Plastic weigh boats
· Agarose powder
· 1x TBE Buffer
· Loading dye
· Sterile water
· 250mL Erlenmeyer flask
· 100mL graduated cylinder
· Scale/balance
· Microwave
· Rubber hot hands for handling hot glassware
· Gel mold and gel comb
Procedure
1. Obtain a 250mL Erlenmeyer flask.
2. Using plastic weigh boats and scale, weigh out 0.48g agarose powder. Pour into Erlenmeyer flask.
3. Using 100mL graduated cylinder, measure 40mL of 1x TBE. Add to Erlenmeyer flask and swirl.
4. Bring contents of flask to a boil in microwave. (Approx. 1-2 min.)
5. Remove flask from microwave using rubber hot pads and carefully swirl contents of flask.
6. Return flask to microwave and boil contents for a second time. (This will only take a few seconds.)
7. Remove flask from microwave and allow to cool.
Cool until the flask can be held comfortably without rubber hot pads. Do not allow agarose to solidify.
8. Obtain a gel mold, and gel comb.
Set up the gel mold while the agarose from step 7 is cooling.
9. Carefully pour agarose mixture into gel mold.
Pour a thin layer, just enough to fully cover the bottom of the gel mold.
10. Immediately place comb into gel, and allow gel to fully solidify.
After pouring the agarose and placing the comb, do not disturb the gel mold. Once the agarose has solidified, remove the comb to create the wells.
11. Place the hardened gel into a tupperware container and fill with water or buffer until the gel is submerged.
12. In a microcentrifuge tube, prepare practice loading solution. Mix the following:
50 μL sterile water
10 μL loading dye
13. Load 12 μL of loading solution into each well of the practice gel. Be sure to stabilize your pipetting hand. Some people find it helpful to place elbows on the bench or help guide with the other hand. After dispelling the solution into the well, do not lift the pipette plunger until the pipette is fully out of the buffer.
Protocol #1.2: Visualization of Total DNA
This protocol is designed to 1) test the success of the DNA extraction, 2) familiarize students with agarose gel electrophoresis, and 3) allow visual comparison of genomic vs. PCR-amplified DNA. Loading genomic DNA should result in a “smear” of fluorescent DNA in each lane because genomic DNA contains fragments of many sizes that migrate at different speeds through the agarose gel (compare to the specific band of the PCR product visualized in Protocol #3). Agarose and fluorescent stain volumes may need to be adjusted based on the size of the gel box and mold.
Materials/Equipment
· Pipettes and pipet tips
· Plastic weigh boats
· Agarose powder
· 1x TBE Buffer
· GelStarTM fluorescent stain (or other nucleic acid gel stain)
· Loading dye
· Sterile water
· 250mL Erlenmeyer flask
· 100mL graduated cylinder
· Scale/balance
· Microwave
· Rubber hot hands for handling hot glassware
· Gel box and power supply
· Gel mold and gel comb
Procedure
14. Obtain a 250mL Erlenmeyer flask.
15. Using plastic weigh boats and scale, weigh out 0.48g agarose powder. Pour into Erlenmeyer flask.
16. Using 100mL graduated cylinder, measure 40mL of 1x TBE. Add to Erlenmeyer flask and swirl.
Note: 40 mL of 1x TBE and 0.48g of agarose results in a 1.2% agarose gel.
17. Bring contents of flask to a boil in microwave. (Approx. 1-2 min.)
18. Remove flask from microwave using rubber hot pads and carefully swirl contents of flask.
19. Return flask to microwave and boil contents for a second time. (This will only take a few seconds.)
20. Remove flask from microwave and allow to cool.
Cool until the flask can be held comfortably without rubber hot pads. Do not allow agarose to solidify.
21. Obtain a gel box, gel mold, and gel comb.
Set up the gel box apparatus while the agarose from step 7 is cooling.
22. Add 4 μL of GelStar to the cooled liquid agarose and swirl to mix.
23. Carefully pour agarose mixture into gel mold.
Pour a thin layer, just enough to fully cover the bottom of the gel mold.
24. Immediately place comb into gel, and allow gel to fully solidify.
After pouring the agarose and placing the comb, do not disturb the gel mold. Once the agarose has solidified, remove the comb to create the wells.
25. Place the gel mold containing the hardened gel into the gel box. Position the gel so that wells are positioned on the same side as the black nodes of rig cover.
Note: Electric current is used to move negatively charged DNA through the gel towards positive charge.
26. Fill the gel box with 1x TBE until the gel is submerged.
27. In a microcentrifuge tube, prepare DNA samples for loading. Mix the following:
5 μL of extracted fish DNA
5 μL sterile water
2 μL loading dye
28. Load 12 μL of marker into the first well of the gel, followed by the DNA samples from step 14 in subsequent wells.
When loading wells, be careful not to puncture a hole in the gel. It is often helpful to have two hands on the pipet and have elbows on the lab bench for greater stability.
29. Close the gel box, attach to power supply, and set voltage to ~120V.
Run the gel until the first dye band is 0.5-1.0 inches from the end of the gel (approx. 1hr).
30. Turn off power to the gel rig and remove the gel.
31. Image the DNA in the gel using a digital gel imager or a UV light box and film in a dark room.
Protocol #1.3: Designing Primers for PCR Amplification of Fish DNA Samples
This protocol outlines the process of designing PCR primers using specific bioinformatics tools available online. The goal of this project is to design effective primers for the PCR amplification of the mitochondrial cytochrome c oxidase subunit 1 (COI or COX1) gene. Primers must be able amplify a region of this gene in multiple fish species because the species identity of each fish sample is unknown.
Materials/Equipment
· Computer with Internet access
Procedure
1. Find the scientific name for yellowfin tuna, atlantic salmon, and halibut.
2. Go to the National Center for Biotechnology Information (NCBI) website and select “Nucleotide” from the options given to you in the search window. This will limit your search to their database containing all of the nucleic acid sequences that have been submitted.
3. Find the entire mitochondrion genome sequences for these three species (you will have to use their scientific names).
4. Once you have found their mitochondrion genome sequences, you will be able to select for just the COI region.
5. Using the FASTA form of the COI region, copy and paste these sequences into the European Bioinformatics Institute’s MUSCLE sequence alignment software.
6. Analyze the alignment and design primers for successfully amplifying the COI region.
Things to consider:
· Primers should be 18-25 base pairs long.
· Design primers based on areas of the COI gene that are well conserved between fish species (areas of the alignment without mismatches). This will increase the likelihood that the primers will bind to the genome of an unknown fish species.
· Primers should not have long runs of one nucleotide or dinucleotide repeats (e.g. ATATAT).
· Aim for a GC content between 40 and 60%
· Primers should have a melting temperature (Tm) between 55°C and 70°C, and optimally within 5°C of each other.
· The reverse primer will be designed by using the reverse complement of the sequences obtained from databases.
To analyze your primer choices, it may helpful to use one of the many primer analysis tools available online, such as Integrated DNA Technologies’ OligoAnalyzer (https://www.idtdna.com/calc/analyzer).
7. Type out sequences of forward and reverse primers in 5’-3’ format. For example:
FishForwardPrimer: 5’ ATCGATCGATCGATCGATCG 3’
FishReversePrimer: 5’ CGTACGTACGTACGTACGTA 3’
*If you are interested, take a minute or two to visit boldsystems.org, a database containing all of the COI regions that have already been sequenced as part of the International Barcode of Life initiative.
Protocol #2: PCR Amplification of COI Gene
This protocol is designed to amplify a ~650 base pair region of the mitochondrial cytochrome c oxidase subunit 1 gene (COI or COX1) from the extracted DNA of fish samples. Primers are designed to amplify this region in a variety of fish species. Primer sequences were obtained from Ward et al., 2005.
Materials/Equipment
· Pipettes and filtered pipet tips
· PCR tubes
· HotStar Taq Master Mix Kit (supplied by QIAGEN Inc., product # 203443)
· FishF1 and R1 primers,10μM concentration (sequences listed below)