Supplemental Table S1: Sequences of the Target Gene Primers

Supplemental Tables

Supplemental Table S1: Sequences of the target gene primers

Target genes Primers Base sequence (5'to3')
DDR1 F ACTTTGGCATGAGCCGGAAC
R ACGTCACTCGCAGTCGTGAAC
GAPDH F TGCACCACCAACTGCTTAGC
R GGCATGGACTGTGGTCATGAG
Supplemental Table S2: Summary of genes with > 2 fold differences between the ER and nER patient groups
Gene name / Gene acronym / Fold / Molecular_function
Tumor-associated calcium signal transducer 1 / TACSTD1 / 8.31 / homotypic calcium-independent cell adhesion molecule
Vanin 1 / VNN1 / 4.63 / hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds// GPI anchor binding
Glypican 3 / GPC3 / 3.84 / GPI anchor binding
Epiplakin 1 / EPPK1 / 3.75 / structural molecule activity
Sulfotransferase family, cytosolic,1C, member 1 / SULT1C1 / 3.61 / sulfotransferase activity
Leucine rich repeat containing 1 / LRRC1 / 3.48 / protein binding
Ectonucleotide pyrophosphatase/phosphodiesterase 5 / ENPP5 / 3.45 / hydrolase activity
Zinc finger protein 528 / ZNF528 / 3.38 / nucleic acid binding // zinc ion binding
UDP glucuronosyltransferase 1 family, polypeptide A8 /// UDP glucuronosyltransferase 1 family, polypeptide A9 / UGT1A8 /// UGT1A9 / 3.34 / UDP-glycosyltransferase activity
Chromosome 1 open reading frame 106 / C1orf106 / 3.25
LON peptidase N-terminal domain and ring finger 2 / LONRF2 / 2.92 / ATP-dependent peptidase activity// protein binding// zinc ion binding
SRY (sex determining region Y)-box 4 / SOX4 / 2.91 / transcription factor activity// DNA binding
Solute carrier family 44, member 3 / SLC44A3 / 2.91
Phosphoserine phosphatase / PSPH / 2.90 / phosphoserine phosphatase activity// hydrolase activity// catalytic activity
Hexokinase domain containing 1 / HKDC1 / 2.90 / nucleotide binding // transferase activity
Pleckstrin homology-like domain, family A, member 2 / PHLDA2 / 2.74
CD24 molecule / CD24 / 2.71 / receptor activity// protein binding
Protocadherin 20 / PCDH20 / 2.69 / calcium ion binding // protein binding
Papilin, proteoglycan-like sulfated glycoprotein / PAPLN / 2.65 / metalloendopeptidase activity //serine-type endopeptidase inhibitor activity // protein binding
WW domain binding protein 5 / WBP5 / 2.65
Kelch-like 13 (Drosophila) / KLHL13 / 2.61 / protein binding
Calmodulin binding transcription activator 1 / CAMTA1 / 2.60
Dystrobrevin, alpha / DTNA / 2.55 / calcium ion binding // protein binding // zinc ion binding
X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound / XPNPEP2 / 2.55 / metalloexopeptidase activity // X-Pro aminopeptidase activity // metal ion binding // GPI anchor binding // metallopeptidase activity // hydrolase activity
Drebrin 1 / DBN1 / 2.48 / actin binding // profilin binding // protein binding
Frizzled homolog 7 (Drosophila) / FZD7 / 2.46 / G-protein coupled receptor activity // signal transducer activity // oxidoreductase activity
Chromosome 8 open reading frame 72 / C8orf72 / 2.44
Zinc finger protein 204 / ZNF204 / 2.43 / nucleic acid binding // zinc ion binding // metal ion binding
Discoidin domain receptor family, member 1 / DDR1 / 2.42 / nucleotide binding // transmembrane receptor protein tyrosine kinase activity // ATP binding
Zinc finger protein 610 / ZNF610 / 2.42 / nucleic acid binding // zinc ion binding // metal ion binding
Mitogen-activated protein kinase 13 / MAPK13 / 2.34 / nucleotide binding // protein-tyrosine kinase activity // MAP kinase activity // protein binding // ATP binding // transferase activity
ADAM metallopeptidase with thrombospondin type 1 motif, 5 (aggrecanase-2) / ADAMTS5 / 2.33 / metalloendopeptidase activity // integrin binding // zinc ion binding // protein prenyltransferase activity // hydrolase activity
Olfactomedin-like 3 / OLFML3 / 2.32
Collagen, type V, alpha 2 / COL5A2 / 2.30 / extracellular matrix structural constituent // structural molecule activity
Hypothetical protein LOC120376 / LOC120376 / 2.28
Transcribed locus / 2.26
Chromosome 5 open reading frame 13 / C5orf13 / 2.26 / protein binding // tRNA binding // structural constituent of ribosome
Unc-5 homolog C (C.elegans)-like / UNC5CL / 2.24 / protein binding
QuiescinQ6 / QSCN6 / 2.20 / electron carrier activity // protein disulfide oxidoreductase activity // thiol oxidase activity
CDNA FLJ33420fis, clone BRACE2020028 / 2.20
Feline leukemia virus subgroup C cellular receptor / FLVCR / 2.19 / receptor activity // transporter activity
EPS8-like 3 / EPS8L3 / 2.18
Glutathione S-transferase M3 (brain) / GSTM3 / 2.17 / glutathione transferase activity
Stanniocalcin 1 / STC1 / 2.17 / protein kinase activity // hormone activity // ATP binding
Cyclin-dependent kinase inhibitor 1C (p57,Kip2) / CDKN1C / 2.17 / cyclin-dependent protein kinase inhibitor activity // protein binding
Solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 / SLC7A1 / 2.15 / receptor activity // amino acid-polyamine transporter activity // basic amino acid transporter activity // amino acid permease activity
Pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 / PLEKHH2 / 2.12 / binding
Nebulette / NEBL / 2.11 / actin binding // zinc ion binding // structural constituent of muscle // metal ion binding
Geminin, DNA replication inhibitor / GMNN / 2.08 / protein binding
Glutathione S-transferase A4 / GSTA4 / 2.08 / glutathione transferase activity
Vang-like 2 (van gogh, Drosophila) / VANGL2 / 2.07 / protein binding
Laminin, beta 1 / LAMB1 / 2.06 / extracellular matrix structural constituent // protein binding // structural molecule activity
Cadherin 6, type 2, K-cadherin (fetal kidney) / CDH6 / 2.06 / calcium ion binding // protein binding
Prickle homolog 2 (Drosophila) / PRICKLE2 / 2.05 / zinc ion binding // metal ion binding
Hypothetical protein LOC727916 / LOC727916 / 2.05
E2F transcription factor 3 / E2F3 / 2.04 / transcription factor activity // protein binding // DNA binding
NCK adaptor protein 2 / NCK2 / 2.03 / protein binding // cytoskeletal adaptor activity // receptor signaling complex scaffold activity
Tight junction protein 3 (zona occludens 3) / TJP3 / 2.03 / protein binding
Jub,ajuba homolog (Xenopus laevis) / JUB / 2.02 / zinc ion binding // metal ion binding
Choroideremia-like (Rab escort protein 2) / CHML / 2.01 / Rab-protein geranylgeranyltransferase activity // Rab escort protein activity // GTPase activator activity // rhodopsin-like receptor activity // signal transducer activity // G-protein coupled receptor activity // photoreceptor activity
Small trans-membrane and glycosylated protein / LOC57228 / 2.01

Supplemental Table S3: 49 genes down-regulated in the ER group by more than 2-fold compared with that in the nER group.

Gene name / Gene symbol / Fold / Molecular_function
hydroxyprostaglandin dehydrogenase 15-(NAD) / HPGD / 0.11 / prostaglandin-D synthase activity // prostaglandin E receptor activity // 15-hydroxyprostaglandin dehydrogenase (NAD+) activity // oxidoreductase activity // protein homodimerization activity // NAD binding // catalytic activity
membrane metallo-endopeptidase (neutral endopeptidase,enkephalinase) / MME / 0.24 / neprilysin activity // metallopeptidase activity // zinc ion binding // metal ion binding // hydrolase activity
autocrine motility factor receptor / AMFR / 0.24 / ubiquitin-protein ligase activity // receptor activity // protein binding // zinc ion binding // ligase activity // metal ion binding
synovial sarcoma, X breakpoint 1 / SSX1 / 0.24 / nucleic acid binding // transcription corepressor activity
Zinc finger protein 718 / ZNF718 / 0.25 / nucleic acid binding // DNA binding // zinc ion binding // metal ion binding
ATP-binding cassette, sub-family A (ABC1), member 8 / ABCA8 / 0.26 / nucleotide binding // ATP binding // ATPase activity, coupled to transmembrane movement of substances // nucleoside-triphosphatase activity
cytochrome c oxidase subunit VIIb2 / COX7B2 / 0.26 / cytochrome-c oxidase activity // oxidoreductase activity
serine dehydratase / SDS / 0.26 / catalytic activity // L-serine ammonia-lyase activity // lyase activity
Adrenergic, alpha-1A-, receptor / ADRA1A / 0.29 / rhodopsin-like receptor activity // receptor activity // adrenoceptor activity // signal transducer activity // G-protein coupled receptor activity // melanocortin receptor activity
phosphoenolpyruvate carboxykinase 1 (soluble) / PCK1 / 0.30 / nucleotide binding // phosphoenolpyruvate carboxykinase (GTP) activity // GTP binding // carboxy-lyase activity
complement factor H-related 4 / CFHR4 / 0.32 / lipid transporter activity
cystathionase (cystathionine gamma-lyase) / CTH / 0.33 / cystathionine gamma-lyase activity // lyase activity
BCL2-like 10 (apoptosis facilitator) / BCL2L10 / 0.34 / protein binding
ATP-binding cassette, sub-family B (MDR/TAP), member 11 / ABCB11 / 0.35 / nucleotide binding // transporter activity // ATP binding // sodium-exporting ATPase activity, phosphorylative mechanism // bile acid-exporting ATPase activity // ATPase activity // nucleoside-triphosphatase activity // ATPase activity, coupled to transmembrane movement of substances
bone marrow stromal cell antigen 2 / BST2 / 0.36 / signal transducer activity // GPI anchor binding
G protein-coupled receptor 125 / GPR125 / 0.36 / receptor activity // G-protein coupled receptor activity // protein binding // signal transducer activity
aquaporin 9 / AQP9 / 0.37 / amine transporter activity // purine transporter activity // pyrimidine transporter activity // polyol transporter activity // porin activity // carboxylic acid transporter activity // water transporter activity // transporter activity // water channel activity
lymphocyte antigen 96 / LY96 / 0.38 / coreceptor activity
glutamic pyruvate transaminase (alanine aminotransferase) 2 / GPT2 / 0.38 / alanine transaminase activity // 1-aminocyclopropane-1-carboxylate synthase activity // transaminase activity // transferase activity, transferring nitrogenous groups
apolipoprotein A-V / APOA5 / 0.39 / lipid transporter activity // triglyceride binding // lipid binding
transforming growth factor, beta receptor III (betaglycan,300kDa) / TGFBR3 / 0.40 / receptor activity // glycosaminoglycan binding
SEC14-like 2 (S.cerevisiae) / SEC14L2 / 0.41 / transporter activity // carrier activity // phospholipid binding // vitamin E binding // transcriptional activator activity //lipid binding
mitochondrial ribosomal protein L43 / MRPL43 / 0.41 / structural constituent of ribosome // translation regulator activity
nudix (nucleoside diphosphate linked moiety X)-type motif 16 pseudogene / NUDT16P / 0.41 / hydrolase activity
arginase, type II / ARG2 / 0.42 / arginase activity // hydrolase activity // manganese ion binding // metal ion binding // hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines
steroid-5-alpha-reductase, alpha polypeptide 2 / SRD5A2 / 0.42 / 3-oxo-5-alpha-steroid 4-dehydrogenase activity // sterol 5-alpha reductase activity // oxidoreductase activity
CD1d molecule / CD1D / 0.42 / receptor activity // beta-2-microglobulin binding // exogenous lipid antigen binding // protein heterodimerization activity
aminoadipate-semialdehyde synthase / AASS / 0.42 / peroxidase activity // lysine-ketoglutarate reductase activity // oxidoreductase activity // saccharopine dehydrogenase (NADP+, L-lysine-forming) activity // catalytic activity
hect domain and RLD 5 / HERC5 / 0.43 / ubiquitin-protein ligase activity // ligase activity
zinc finger and BTB domain containing 16 / ZBTB16 / 0.43 / DNA binding // zinc ion binding // specific transcriptional repressor activity // protein homodimerization activity // metal ion binding // protein binding // identical protein binding // nucleic acid binding
ST3 beta-galactoside alpha-2,3-sialyltransferase 6 / ST3GAL6 / 0.43 / sialyltransferase activity // transferase activity // transferase activity, transferring glycosyl groups
estrogen receptor 1 / ESR1 / 0.43 / transcription factor activity // steroid hormone receptor activity // steroid binding // protein binding // zinc ion binding // lipid binding // nitric-oxide synthase regulator activity //estrogen receptor activity // sequence-specific DNA binding // metal ion binding // DNA binding // receptor activity // ligand-dependent nuclear receptor activity
mitogen-activated protein kinase kinasekinase 5/// hypothetical protein LOC729144 /// hypothetical protein LOC732274 / MAP3K5/// LOC729144 /// LOC732274 / 0.44 / nucleotide binding // magnesium ion binding // protein serine/threonine kinase activity // MAP kinase kinasekinase activity // ATP binding // caspase activator activity // transferase activity // identical protein binding // protein binding // protein kinase activity // kinase activity // metal ion binding
EF-hand domain family, member A2 / EFHA2 / 0.44 / calcium ion binding
absent in melanoma 1 / AIM1 / 0.44 / molecular_function // sugar binding
follistatin / FST / 0.44 / protein binding // activin inhibitor activity
SEC14-like 2 (S.cerevisiae) / SEC14L2 / 0.45 / transporter activity // carrier activity // phospholipid binding // vitamin E binding // transcriptional activator activity // lipid binding
ST3 beta-galactoside alpha-2,3-sialyltransferase 6 / ST3GAL6 / 0.45 / sialyltransferase activity // transferase activity // transferase activity, transferring glycosyl groups
apolipoprotein C-IV / APOC4 / 0.46 / lipid transporter activity // enzyme activator activity // lipoprotein lipase activity
adrenergic, beta-2-, receptor, surface / ADRB2 / 0.46 / rhodopsin-like receptor activity // receptor activity // beta2-adrenergic receptor activity // protein binding // protein homodimerization activity // norepinephrine binding //signal transducer activity // G-protein coupled receptor activity // adrenoceptor activity
alcohol dehydrogenase 6 (class V) / ADH6 / 0.47 / alcohol dehydrogenase activity // zinc ion binding //electron carrier activity // oxidoreductase activity // metal ion binding
v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) / MYCL1 / 0.47 / transcription factor activity // DNA binding
ATP-binding cassette, sub-family C (CFTR/MRP), member 9 / ABCC9 / 0.47 / nucleotide binding // receptor activity // transporter activity // ATP binding // sulfonylurea receptor activity // ATPase activity, coupled to transmembrane movement of substances
mitogen-activated protein kinase kinasekinase 5 / MAP3K5 / 0.48 / nucleotide binding // magnesium ion binding // protein serine/threonine kinase activity // MAP kinase kinasekinase activity // ATP binding // caspase activator activity // transferase activity // identical protein binding // protein binding // protein kinase activity // kinase activity //metal ion binding
peroxisome proliferator-activated receptor gamma, coactivator 1 alpha / PPARGC1A / 0.48 / nucleotide binding // DNA binding // RNA binding // transcription factor binding // RNA polymerase II transcription mediator activity // ligand-dependent nuclear receptor transcription coactivator activity // androgen receptor binding // protein binding
sorting nexin 10 / SNX10 / 0.49 / protein binding // phosphoinositide binding
CD72 molecule / CD72 / 0.50 / transmembrane receptor activity // receptor binding // sugar binding // protein binding // receptor activity
Ceruloplasmin (ferroxidase) / CP / 0.50 / ferroxidase activity // copper ion transporter activity // copper ion binding // oxidoreductase activity // metal ion binding
splicing factor, arginine/serine-rich 2B / SFRS2B / 0.50 / nucleotide binding