Teachable Unit: Executive Summary
Summer Institute- West Virginia University, June 2013
Team Members:
Trista Strauch, University of Missouri
Tasia Taxis, University of Missouri
Lauren Schultz, Macmillan/WH Freeman
Lindsey Veautour, Macmillan/WH Freeman
Facilitator: John Merrill, University of Michigan
Title: Students Constructing Their Own Knowledge to UnderstandMutation
Teaching Challenge
Students memorize a definition of mutation as a “change in the genetic material,” but hold onto misconceptions that are at odds with this definition.
- Students associate value with mutations (i.e. all mutations are bad/harmful, all mutations are good/beneficial)
- Students identify something as a mutation only if it affects a change in the protein or in the phenotype of the organism (disregarding silent mutations and missense mutations with no resulting phenotypic change).
Learning Objectives
- Students will formulate a working definition of a mutation and use it to assess whether a mutation has occurred.
- Given various scenarios, students will be able to evaluate whether a mutation will lead to a phenotypic variation.
- Students will be able to predict how a given mutation would change an individual’s fitness in a specific environment.
- Students will be able to show that mutations comprise the basis of genetic variability in a population.
Brief Description of the Teachable Unit
The teachable unit is a student-centered approach to teaching mutations. In this teachable unit, students follow a series of guided-inquiry clicker questions, participate in analyzing and discussing scenarios, and make predictions abouttwo mini case studies.
This unit would be appropriate for introductory biology (majors or non-majors), introduction to zoology, or an introductory genetics course. This teachable unit represents one class period (50 minutes) and includes pre-class and post class assignments ideas, as well as suggestions for summative assessment.
At this point in the semester, students have been exposed to the central dogma.
Overall sequence of activities:
- Pre Class
- Students read the chapter in their textbook on mutations.
- Students answer a series of low-order, knowledge-based questions on basic terminology and definitions related to mutations.
- IN CLASS
Tidbit 1: The 30 Second Sentence and Guided-Inquiry Clicker Questions- Defining a mutation.
- Students write down a one-sentence definition of mutation and put it to the side.
- Using clickers, students decide whether something is a mutation based on the given information.
- Students consult their one-sentence definitions and discuss their votes with their partner.
- The instructor leads the class in a group discussion about which scenarios are mutations—students will now have derived their own working definition of what mutation means.
Tidbit 2: Double-Muscle Cow Scenario- Mutations are not inherently good or bad.
- All students are given the same scenario on a specific mutation found in cattle, but half the class gets additional information extolling the positive effects of the mutation, and the other half gets additional information pointing out the negative effects.
- Students read their scenario and vote whether it is positive or negative (the voting should be split fairly 50/50). Have students discuss as a group and decide whether the mutation is “positive” or “negative” and defend their answer to the class.
- During the class discussion it is revealed that the exact same mutation can be seen as both positive or negative, confirming for students that mutations are simply a change in genetic material and the presence of a mutation does not communicate any information about value.
Tidbit 3: Sickle-Cell Case Study- Mutations can affect an organism’s fitness based on environment.
- Students are presented with a case study where the negative effects of a mutation are discussed (shortened lifespan, episodes of severe pain). Students vote whether this gene variant will persist in the population and then discuss their vote with their classmates.
- Students may assume that this mutation would not persist. The instructor asks why, and a discussion ensues. The instructor then reveals that, in fact, the mutation does persist, and asks the students why that might be. They discuss in groups and then share their logic. The instructor than reveals the positive effects of the mutation (in specific environments, it can serve as a protection against a fatal disease). With this combined information, students review their previous statements.
- Through discussion, students should be guided to the conclusion that mutations are not inherently good or bad, but can be beneficial or harmful or neutral depending on the environment.
Tidbit 4: Coat Color Variation Scenario- Mutations comprise the basis of genetic variability.
- Students are presented with a final scenario where a small group of animals moves from the mainland to an island, founding a new population, and after some time a new pattern variation appears where there was once only a coat color variation.
- Using the knowledge about mutations students have constructed during class, they should be able to see that the root cause of this is mutation, and that mutations have the ability to increase variation in a species.
3. POST CLASS
- Homework Assignment 1: Students would fill in the table below, giving them a chance to practice and solidify their understanding of what a mutation is. This exercise provides additional practice at identifying mutations, supporting Learning Objective 1 and reinforcing the activity labeled “Tidbit One.”
Fill In the Blank Table(Instructor Answer Key in BLUE)
Question # / Change in DNA / Change in Protein / Change in Phenotype / Effect on Organism / Is this a Mutation? / Why or Why Not?1 / Yes / Yes / Yes / Negative / Y / There is a change in DNA.
2 / Yes / Yes / Yes / Positive / Y / There is a change in DNA.
3 / Yes / Yes / Yes / None / Y / There is a change in DNA.
4 / Yes / Yes / No / None / Y / There is a change in DNA.
5 / Yes / No / No / None / Y / There is a change in DNA.
6 / No / Yes / No / None / N / No change in DNA.
7 / No / No / No / None / N / No change in DNA.
Question related to row 5
How can there be a change in the DNA that does not result in a change in the protein?
Student responses should include discussions of silent mutations, mutations in non-coding region of DNA.
- Homework Assignment 2: Students are given an alternate version of the scenario presented in Tidbit 4. This could also serve as a summative assessment.
Homework Scenario (Instructor Answer Key in BLUE)
You have new variations of haircoat—dark with stripes, dark with no stripes, light with stripes, and light with no stripes. Consider the selective pressures that might exist on an island, and how this variation in coat color and pattern could impact survival and fitness in different habitats on the island. Pick one of the coat colors and describe an environment on this island where you think this variant would have better fitness than the other variants.
Student responses should include a defense of why one of the four phenotypes would improve fitness for that specific organism in a specific environment.
4. SUMMATIVE ASSESSMENT
Assessing Learning Objectives 1 and 2
Correctly answering Question Series A would indicate a student’s ability to identify when a mutation has occurred, decide whether or not a mutation will lead to a phenotypic variation, and suggest an overall understanding of what a mutation is.
QUESTION SERIES A
ACTGCCTGATACATGTAGGC
Based on the sequence above decide whether a mutation occurred, and predict any effect on the population.
a)Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to an A.
Did a mutation occur? Y
Effect on population: None, non-coding region resulting in no phenotype change.
b)Suppose the sequence shown above is part of the non-coding portion of a chromosome. The first G from the left in the above sequence changes to a C.
Did a mutation occur? Y
Effect on population: None, non-coding region resulting in no phenotype change.
c)Suppose the sequence shown above is part of the coding region of a gene. The C in red, above, is somehow changed to be a G, causing the resulting protein (a metabolic enzyme) to become non-functional
Did a mutation occur? Y
Effect on population: Yes, there is an effect.
d)Suppose the sequence shown above is part of the coding region of a gene. If the C in red is somehow changed to be a G, but causes no negative effect on the resulting protein (a metabolic enzyme), would it be a mutation?
Did a mutation occur? Y/N
Effect on population: Yes, there is an effect.
Assessing Learning Objectives 3 and 4
The Homework Assignment #2 provided above would also be an appropriate summative assessment problem that would indicate a student’s ability to incorporate topics of fitness and environment into their understanding of mutations and their effects.
How does this teachable unit address the following themes?
Active Learning/Student Learning: This teachable unit departs from traditional lecture, and instead allows students to construct their own knowledge about mutations. Guided-inquiry, clicker questions, 30-second sentence (modification of a one-minute paper), brainstorming, debating, polling, case studies and scenarios represent a variety of student-centered activities to increase class engagement and do less “telling” and more “discovery.”
Assessment: Carefully constructed homework questions are designed to give students practice with the concept of mutation and the summative assignments are aligned appropriately with the in-class activities.
Diversity: The scenarios used in this teaching tidbits span from human mutations and disease (sickle-cell, malaria), to animal science (cattle mutations), to non-species specific scenarios that allow students to imagine an environment and species of their choice. This diversity of topics was deliberate—hoping to engage students across a variety of interests.