POGIL 2 biol 212 – Translation

Gene expression. Gene expression is the process of using a gene to generate either a protein or a functional RNA.. The gene contains a series of nucleotides which are ‘read’ by cellular enzymes to produce a protein or functional RNA. The order of nucleotides in the gene determines the amino acids which will be joined to produce a protein. Different genes have different nucleotides, hence encode different proteins. The decoding process first copies the nucleotides in the gene into a messenger RNA molecule during a process called transcription. The ribosome then reads the RNA molecule and produces a protein according to the order of nucleotides on the RNA in a process called translation.

Model 1


Using the diagrams above, your textbook, and your note set, answer the following questions.

1.  In model 1, point out the subunits of the ribosome?

2.  What is the ribosome composed of?

3.  Where in model 1 is the RNA transcript?

4.  Record the nucleotides (on this sheet) in the open reading frame (ORF) present in model 1.

5.  What is the first codon in this ORF? The second? The last? Which is the stop codon?

6.  In model 1, which is the transfer RNA? The amino acid? What is the purpose of the transfer RNA?

7.  In model 1, where do you find the codons? The anticodons?

8.  Explain how the interactions between the codon and anticodon determine the order and identity of amino acids in the resulting protein.

9.  Where in model 1 is the growing (or nascent) protein? What is a peptide? Explain the steps that occur as the protein grows.

10.  What occurs when the ribosome reaches the stop codon?

11.  Is DNA directly involved with translation?why or why not?

12.  What is a mutation (explain your answer in terms of the gene and open reading frames)?

13.  Employing your codon usage table (notes and in book), determine the amino acid identity and order in the protein if you mutated all the A’s to C’s. Is this different than the original protein?

14.  You have discovered a chemical that plugs up the nuclear pores. How would you expect this chemical to affect translation in eukaryotic organisms? Prokaryotic organisms? Explain you answer.

15.  Listed below is a stretch of double stranded DNA. Add the missing 3’/5’ designations. Which is the coding strand? Find the gene (ORF) and transcribe it into mRNA, then translate it into a protein using the codon table in your book.

5’TTAATTTCGGGCGGGAGAGATGCCCGGGGCGGTTATTAGGCCACCTCCCATTTAA

AATTAAAGCCCGCCCTCTCTACGGGCCCCGCCAATAATCCGGTGGAGGGTAAATT