Dan Hu, et al. HR-01101035

A Novel Rare Variant in SCN1Bb Linked to Brugada Syndrome and SIDS by Combined Modulationof

Nav1.5 and Kv4.3 Channel Currents

Short Title: Hu: SCN1Bb Rare Variant Associated with BrS and SIDS

Dan Hu, MD, PhD1#, Hector Barajas-Martínez, PhD1#, Argelia Medeiros-Domingo,MD, PhD2#, Lia Crotti, MD, PhD3-5#, Christian Veltmann, MD6, Rainer Schimpf, MD6, Janire Urrutia, PhD7, Aintzane Alday, PhD7, Oscar Casis, MD, PhD7, Ryan Pfeiffer, BS1, Elena Burashnikov, BS1, Gabriel Caceres, BS1, David J. Tester, BS2, Christian Wolpert, MD8, Martin Borggrefe, MD6, Peter Schwartz, MD3,5,9-12, Michael J. Ackerman, MD, PhD2, Charles Antzelevitch, PhD, FHRS1*

#Authors contributed equally

1Masonic Medical Research Laboratory, Utica, New York, United States of America, 2Windland Smith Rice Sudden Death Genomics Laboratory, Mayo Clinic, Rochester, Minnesota, United States of America,3Department of Lung, Blood and Heart, Section of Cardiology, University of Pavia, Pavia, Italy, 4 Institute of Human Genetics, Helmholtz Zentrum Muenchen, Neuherberg, Germany, 5 Department of Cardiology, IRCCS Policlinico S. Matteo, Pavia, Italy, 6 University Medical Centre Mannheim,Mannheim, Germany, 7Universidad del País Vasco, Department of Physiology, Leioa, Spain,8Klinikum Ludwigsburg, Ludwigsburg, Germany,9Laboratory of Cardiovascular Genetics, IRCCS Istituto Auxologico Italiano, Milan, Italy,10Cardiovascular Genetics Laboratory, Hatter Institute for Cardiovascular Research, Department of Medicine, University of Cape Town, South Africa, 11Department of Medicine, University of Stellenbosch, South Africa, 12Chair of Sudden Death, Department of Family and Community Medicine, College of Medicine, King Saud University, Riyadh, Saudi Arabia.

*Address for editorial correspondence and reprint requests:

Charles Antzelevitch, PhD., FAHA, FACC, FHRS,

Gordon K. Moe Scholar

Masonic Medical Research Laboratory

2150 Bleecker Street,

Utica, New York, U.S.A. 13501-1787

Phone: (315) 735-2217

FAX: (315) 735-5648

E-mail:

Online Supplement

METHODS

Genetic Analysis

Comprehensive open reading frame/splice site genetic analysis was performed using polymerase chain reaction (PCR), denaturing high performance liquid chromatography (DHPLC), and DNA sequencing. All known exons and intron borders of candidate genes for BrS and SIDS, including SCN5A, SCN1B, SCN2B, SCN3B, SCN4B, CACNB2b, CACNA2D1, CACNA1C, IRX5, KCNE1, KCNE2, KCNE3, KCNE4, DPPX, GPD1L,KCNQ1, KCNH2, KCNJ8, KCND3, and MOG1,were amplified with intronic primers and sequenced in both directions to probe for mutations, with the use of an ABI PRISM 3100-Avant Automatic DNA sequencer (Applied Biosystem. Foster City, Calf, USA). The flanking primers used for PCR were published previously or designed with Oligo software (Molecular Biology Insights, Inc., Cascade, Colo, USA), and are available on request.The sequences of primers of SCN1Bb are shown in Online Table 1(Reference Sequence: NM_199037).

Site-Directed Mutagenesis and Transfection of the TSA201 Cell Line

Cloning, mutagenesis, and cell transfection were performed as previously described1. Briefly, site-directed mutagenesis was performed with QuikChange (Stratagene, La Jolla, Calif, USA) on full-length human wild-type (WT) and mutant SCN1Bb cDNA cloned in pIRES2-AcGFP vector, the human SCN5A/WT(hH1c) and the KCND3/WT (long) cloned in pcDNA3.1. SCN1Bb was kindly provided by Dr. Hiroshi Watanabe from Vanderbilt University, Tenn, USA. The mutated plasmid was sequenced to ensure the presence of the target variant without spurious substitutions.

Channels were expressed heterologously inTSA201 cell line using fugene6 (Roche Diagnostics,Indianapolis, Ind). Transient transfectionwas carried out with SCN5A or KCND3 alone, or combined with SCN1Bb (WT or mutant) in a 1:1 molar ratio. The cells were grown in GIBCO DMEM medium(Gibco, Invitrogen cell culture, Carlsbad, Calif, USA) with FBS and antibiotics on polylysine coated culture dishes (Cell+, Sarstedt, Newton, NC, USA). Cells were placed in a 5% CO2 incubator at 37°C within 48 hours prior to patch clamp study. It is noteworthythat previous studies have demonstrated that no endogenous SCN5A and any of its β-subunits are expressed in the TSA201 cell line2, and there is no measurable INa or Ito current in untransfected cells.

Functional Assay

Membrane currents were measured using whole-cell patch-clamp techniques. All recordings were obtained at room temperature (20 - 22°C) using an Axopatch 200B amplifier equipped with a CV-201A head stage (AxonInstruments Inc., Foster City, Calif, USA). Bath solution for INa contained (in mmol/L) 130 NaCl, 5 KCl, 1.8 CaCl2, 1 MgCl2, 2.8 Na Acetate, 10 HEPES, 10 Glucose (pH 7.3 with NaOH). Tetraethylammonium Chloride (5 mmol/ L) was added to the buffer to block TEA-sensitive native currents. Pipettes were filled with a solution containing (in mmol/L) 5 NaCl, 5 KCl, 130 CsF, 1.0 MgCl2, 5 EGTA, 10 HEPES and 5 TEA (pH 7.2 with CsOH). Ito currents were measured using an extracellular solution (mmol/L): 130 NaCl, 2.8 Na Acetate, 4 KCl, 1.8 CaCl2, 1 MgCl2, 10 HEPES, 10 Glucose (pH 7.35 with NaOH), and an intracellular solution (mmol/L): 140 KCl, 1 MgCl2, 10 EGTA, 10 HEPES, 5 MgATP (pH 7.2 with KOH). Patch pipettes were fabricated from 1.5 mm OD borosilicate glass capillaries (Fisher Scientific, Pittsburg, Pa, USA). They were pulled using a gravity puller (Model PP-830, Narishige Corp, Tokyo, Japan) to obtain resistances between 0.8 - 2.8 MΩ. Currents were filtered with a four pole Bessel filter at 5 kHz and digitized at 50 kHz. Series resistance was electronically compensated at around 80%. Current-voltage relationship, activation, inactivation, and recovery from inactivation were performed and analyzed as previously described1, 3.

For sodium recording, measurements were started 8 minutes after obtaining the whole-cell configuration to allow the current to stabilize. Macroscopic whole cell INa current was recorded with holding potential (HP) at -120 mV. INa was elicited by depolarizing pulses ranging from -90 mV to +30 mV in 5 mV increments. Peak currents were measured and INa densities (pA/pF) were obtained by dividing the peak INa by the cell capacitance obtained. Inactivation curve was obtained by plotting the normalized peak current (40-ms test pulse to –20 mV after a 1000-ms conditioning pulse from -140 mV to -60 mV with the HP of -120 mV) vs.Vm. Activation property was determined from I/V relationships by normalizing peak INa to driving force and maximal INa, and plotting normalized conductance vs. Vm.Boltzmann curves were fitted to both activation and steady-state inactivation data. Pulses for recovery from inactivation were of 20 ms duration. Peak current elicited during the second pulse was normalized to the value obtained during the initial test pulse. Then fitting to a double-exponential function yielded the time constants.

Ito current was recorded with HP at -80mV. Ito was elicited by depolarizing pulses ranging from -60 mV to +80 mV in 10 mV increments. Peak currents were measured and Ito densities (pA/pF) were obtained by dividing the peak Ito by the cell capacitance. The total charge was calculated by integrating the first 50 ms and 100 ms of the current elicited by pulses from 0 mV to +80 mV. For recovery, twin pulses of 300 ms duration to +30 mV with a variable interpulse interval from -80mV of HP were applied. Fitting to a double-exponential function yielded the time constants of recovery. Steady-state inactivation of Ito was evaluated using a standard prepulse-test pulse voltage clamp protocol. The peak current following a 1000 ms pre-pulse was determined and plotted as a function of the pre-pulse voltage. Boltzmann curves were fitted to steady-state inactivation data.

All data acquisition and analysis was performed using pCLAMP V10.0 (Axon Instruments, Foster City, Calif, USA), EXCEL (Microsoft, Redmond, Wash, USA), and ORIGIN 7.5 (Microcal Software, Northampton, Mass, USA).

Co-immunoprecipitation and Western Blot

To identify the protein interaction of Navβ1b with Nav1.5 or Kv4.3,we used co-immunoprecipitation and western blot assay in plasmatic membrane of TSA201 cells.Plasmatic membrane was isolated by centrifugation from TSA201 cells previously co-transfected using Navβ1b with either Nav1.5 or Kv4.3 after incubation at 37°C for 48 hrs. 250 μg of membrane proteins were solubilized in 150 μl of RIPA buffer and incubated for 1 hour at 4ºC. Samples were centrifuged 2 minutes at 4000g. 150 μl of the supernatant was obtained and incubated overnight with 2 μg anti-Nav1.5(Santa Cruz Biotechnology, Inc., Santa Cruz, Calif, USA)or anti-Kv4.3antibodies (UC Davis/NIH NeuroMab Facility, Davis, Calif, USA) in 140 μl of RIPA at 4ºC. 100 μl of 50% protein G-sepharose was added and the mixture was incubated for 3 hours at 4ºC. The beads were pelleted and washed three times in RIPA buffer at 4000g for 2 minutes. The bound proteins were eluted using 50 μl of SDS sample buffer.

Immunoprecipitation samples were fractionated on 10% SDS-polyacrylamide gels and transferred to nitrocellulose membranes (Amersham Biosciences/GE Healthcare, Piscataway, NJ, USA). Nitrocellulose membranes were blocked in TTBS solution containing BSA 3%. Blots were incubated with primary antibodies: anti-Navβ1b (1:600, Santa Cruz Biotechnology, Inc., Santa Cruz, Calif, USA), Nav1.5 (1:200, Santa Cruz Biotechnology, Inc., Santa Cruz, Calif, USA) and Kv4.3 (1:200, Santa Cruz Biotechnology, Inc., Santa Cruz, Calif, USA). Secondary antibodies were: donkey anti-rabbit IgG (1:5000), anti-mouse IgG (1:3300) and anti-goat (1:5000). Blots were developed using the West Pico chemiluminiscence reagent. Western blot bands were acquired with a Kodak Gel Logic 2200 and digitized with the Kodak Molecular Imaging 4.0.4 software.

DISCUSSION

Navchannels and their regulatory Navβ subunits underlie the main depolarizing current in excitable tissues, including the heart. In mammals, SCN1B–SCN4Bencode β1, β1A, β1B, β2, β3, and β4, respectively, all of which are present in human heart.1, 4, 5In addition to Navsubunits, Navβ subunits have been shown to also interact with multiple cellular adhesion molecules (CAMs), intracellularcytoskeletal proteins, components of the extracellularmatrix (ECM), enzymes, signalingmolecules and other ion channels (such as Kv4.3).6All Navβ subunits can also potentially serve as drug targets.

Mutations in Navsubunit genes have been associated with a variety of human neurological diseases, such as febrile seizures and generalized epilepsy.6Moreover, mutations in some Navsubunits, particularly Nav1 andNav3, have been associated with cancer.7 The presence of a  subunit is known to modulate the functional consequence and drug response of mutations in Nav1.5,8 supporting the hypothesis that β subunits play a critical role in heart. Genes encodingNav proteins have therefore become attractive candidates for cardiac ion channelopathies.9Online Table 5 summarizes available data concerning the role of mutations in NaV subunits in cardiac channelopathies. Since our publication of the first β3 mutation associated with cardiac disease (BrS7) in 2009,1 it has become the most frequently reported β subunit gene involved in BrS, AF, idiopathic VF and SIDS. However, association of mutations in β2 and β4 with cardiac channelopathies is still fairly rare.

REFERENCES

1. Hu D, Barajas-Martinez H, Burashnikov E, et al.: A mutation in the beta 3 subunit of the cardiac sodium channel associated with Brugada ECG phenotype. Circ Cardiovasc Genet 2009; 2:270-8

2. Maier SK, Westenbroek RE, McCormick KA, Curtis R, Scheuer T, Catterall WA: Distinct subcellular localization of different sodium channel a and b subunits in single ventricular myocytes from mouse heart. Circulation 2004; 109:1421-7

3. Hu D, Viskin S, Oliva A, et al.: Novel mutation in the SCN5A gene associated with arrhythmic storm development during acute myocardial infarction. Heart Rhythm 2007; 4:1072-80

4. Watanabe H, Koopmann TT, Le Scouarnec S., et al.: Sodium channel b1 subunit mutations associated with Brugada syndrome and cardiac conduction disease in humans. J Clin Invest 2008; 118:2260-8

5. Olesen MS, Jespersen T, Nielsen JB, et al.: Mutations in sodium channel {beta}-subunit SCN3B are associated with early-onset lone atrial fibrillation. Cardiovasc Res 2011; 89:786-93

6. Patino GA, Isom LL: Electrophysiology and beyond: multiple roles of Na+ channel beta subunits in development and disease. Neurosci Lett 2010; 486:53-9

7. Sjoblom T, Jones S, Wood LD, et al.: The consensus coding sequences of human breast and colorectal cancers. Science 2006; 314:268-74

8. Makita N, Shirai N, Wang DW, et al.: Cardiac Na+ channel dysfunction in Brugada syndrome is aggravated by b1-subunit. Circulation 2000; 101:54-60

9. Meadows LS, Isom LL: Sodium channels as macromolecular complexes: implications for inherited arrhythmia syndromes. Cardiovasc Res 2005; 67:448-58

10. Watanabe H, Darbar D, Kaiser DW, et al.: Mutations in sodium channel b1 and b2 subunits associated with atrial fibrillation. Circ Arrhythm Electrophysiol 2009; 2:268-75

11. Tan BH, Pundi KN, Van Norstrand DW, et al.: Sudden infant death syndrome–associated mutations in the sodium channel beta subunits. Heart Rhythm 2010; 7:771-8

12. Valdivia CR, Medeiros-Domingo A, Ye B, et al.: Loss-of-function mutation of the SCN3B-encoded sodium channel b3 subunit associated with a case of idiopathic ventricular fibrillation. Cardiovasc Res 2010; 86:393-400

13. Wang P, Yang Q, Wu X, et al.: Functional dominant-negative mutation of sodium channel subunit gene SCN3B associated with atrial fibrillation in a Chinese GeneID population. Biochem Biophys Res Commun 2010; 398:98-104

14. Medeiros-Domingo A, Kaku T, Tester DJ, et al.: SCN4B-encoded sodium channel b4 subunit in congenital long-QT syndrome. Circulation 2007; 116:134-42

Table 1. Oligonucleotide Primers for Genetic Analysis of Navβ1B Subunits

Exon / Forward Primer (5’ to 3’) / Reverse Primer (5’ to 3’)
1 / CTCCCGGGGACATTCTAACC / GCACAACTTCTGAAGCTGAC
2 / CATCCAGTCCTGTCTGCTG / CCAGGTCAGCAATCACAGC
3A / CATCTGTGTTTGTGGGTGTC / CTCAGCCCGCTGCTGTGG
3B / GTGCTGCCTGCCCCTTTAC / GGCTGAGCTACTCGAACAG

Table 2. ECG Characteristics of Affected Patient 1 and Patient 2

RR Interval (ms) / P Wave Duration (ms) / PR Interval (ms) / QRS Duration
(ms) / QT Interval (ms) / QTc Interval (ms)
Patient1-Baseline / 800 / 120 / 200 / 120 / 360 / 402
Patient1-After Ajmaline / 760 / 140 / 240 / 130 / 380 / 436
Patient 2 / 760 / 120 / 190 / 110 / 390 / 447

Table 3. Effects of β-Subunit Co-expression on Equilibrium Gating Parameters of INa

Inactivation / Activation / Recovery
Subunit / V1/2
(mV) / K
(mV) / n / V1/2
(mV) / K
(mV) / n / τf
(ms) / τs
(ms) / n
SCN5A/WT / -95.98±
1.97 / 6.63±
0.43 / 11 / -50.82±
2.16 / 5.60±
0.54 / 9 / 6.34±
0.21 / 37.82±
2.89 / 11
SCN5A/WT+
SCN1Bb/WT / -95.70±
2.02 / 5.97±
0.18 / 10 / -47.02±
2.33 / 5.76±
0.58 / 11 / 6.52±
0.30 / 28.43±
1.77* / 10
SCN5A/WT+
SCN1Bb/R214Q / -95.80±
0.90 / 5.64±
0.30 / 9 / -49.10±
1.77 / 5.62±
0.42 / 12 / 7.43±
0.33* # / 38.23±
3.28# / 9

Parameters of inactivation and activation were calculated from the Boltzmann function. V1/2 is the voltage for half-maximal availability or activation and k is the slope factor. Parameters of recovery were fitted to a double exponential function. τf andτs are the time constant for the fast and slow gating modes of recovery. *P<0.05 vs. SCN5A/wild-type (WT); #P<0.05 vs. SCN5A/WT+SCN1Bb/WT. Data from Figure 4B, 4C and 4D, Means±SEM.

Table 4. Effects of β-Subunit Co-expression on Equilibrium Gating Parameters of Ito

Inactivation / Recovery
Subunit / V1/2
(mV) / K
(mV) / n / τf
(ms) / τs
(ms) / n
KCND3/WT / -42.76±
1.60 / 8.76±
0.19 / 25 / 31.32±
0.95 / 271.61±
12.77 / 17
KCND3/WT + SCN1Bb/WT / -43.47±
2.11 / 7.55±
0.83 / 8 / 35.40±
1.18* / 308.64±
21.40 / 8
KCND3/WT + SCN1Bb/R214Q / -41.70±
2.22 / 8.04±
0.50 / 11 / 31.09±
1.58# / 237.90±
13.53# / 9

Parameters of inactivation were calculated from the Boltzmann function. V1/2 is the voltage for half-maximal availability or activation and k is the slope factor. Parameters of recovery were fitted to a double exponential function. τf andτs are the time constant for the fast and slow gating modes of recovery. *P<0.05 vs. KCND3/wild-type (WT); #P<0.05 vs. KCND3/WT+SCN1Bb/WT. Data from Figure 6B and 6C, Means±SEM.

Table 5. Human Cardiac Disease-Related Sodium Channel β-Subunits Mutations

Gene / Nucleotide / Mutation / Exon / Disease / Functional Consequences
SCN1B / c.254G>A / p.Arg85His / 3 / AF / Reduced INa,peak and alterd gating (CHO)10
c.259G>C / p.Glu87Gln / 3 / CCD / Reduced INa,peak (CHO) 4
c.457G>A / p.Asp153Asn / 4 / AF / Reduced INa,peak (CHO) 10
SCN1Bb / c.536G>A / p.Trp179X / 3A / CCD+BrS / Reduced INa,peak and altered gating (CHO) 4
c.537G>A / p.Trp179X / 3A / CCD
SCN2B / c.82C>T / p.Arg28Trp / 2 / AF+CCD / Reduced INa,peak and altered gating (CHO) 10
c.83G>A / p.Arg28Gln / 2 / AF / Reduced INa and altered gating (CHO) 10
SCN3B / c.17G>A / p.Arg6Lys / 1 / AF / Altered gating of INa,peak (CHO-Pro5) 5
c.29T>C / p.Leu10Pro / 1 / BrS, AF / Reduced INa,peak, altered gating, and trafficking defect (TSA201, CHO-Pro5)1, 5
c.106G>A / p.Val36Met / 2 / SIDS / Reduced INa,peak, augmented INa,late (HEK293) 11
c.161A>C / p.Val54Gly / 2 / SIDS, IVF / Reduced INa,peak , altered gating , and trafficking defect (HEK293, CHO)11, 12
c.389C>T / p.Ala130Val / 3 / AF / ReducedINa,peak (HEK293)13
c.482T>C / p.Met161Thr / 4 / AF / Reduced INa,peak (CHO-Pro5) 5
SCN4B / c.535C>T / p.Leu179Phe / 4 / CCD+LQT / Altered gating of INa,peak, increased INa,late (HEK293)14
c.617G>A / p.Ser206Leu / 5 / SIDS / Increased INa,late (HEK293 and rat myocyte), increased APD90 (rat myocyte)11

- 1 -