Supplemental MATERIALS AND METHODS.
Microarray analysis
cDNAs were amplified from the salt-exposed SSH library and then spotted onto the microarray. cDNAs labeled with a fluorescent dye (Cy5 or Cy3-dCTP) were produced according to Eberwine’s linear RNA amplification method followed by an enzymatic reaction as described by Shi et al. (2006). Labeled cDNA was purified with a PCR purification kit (Qiagen). Labeled control and test samples were quantitatively adjusted based on the efficiency of the Cy-dye incorporation and mixed with 30 µl hybridization solution (50 % formamide, 1× hybridization buffer; Amersham Biosciences). The DNA in the hybridization solution was denatured at 95°C for 3 min prior to loading the sample onto the microarray. The arrays were hybridized at 42°C overnight and washed with two consecutive solutions (0.2% SDS, 2× SSC at 42°C for 5 min, and 0.2× SSC for 5 min) (Shi et al., 2006).
The microarrays were scanned with a ScanArray Express scanner using ScanArray 2.0 software (Packard Bioscience). GenePix Pro 4.0 (Axon Instruments) was used to quantify the signal intensities of individual spots in the 16-bit TIFF images. The microarray slides were hybridized with RNA prepared from three replicates of each biological sample. The signal log ratio indicates the change in the expression level of a transcript between the control and experimental samples, which is expressed as the log2 ratio. The fold change was calculated as 2log ratio when the signal log ratio was ≥ 2.0 and (−1)×2-log ratio when the signal log ratio was < -2.0. The transcripts with a minimum two-fold increase or decrease in signal and a coefficient of variation (CV) < 30% were identified as differentially expressed genes.
RT-PCR analysis
Total RNA was isolated from A. centralasiatica seedlings using TRIzol reagent (GIBCO/BRL, Life Technologies, Gaithersburg, MD, USA). For the RT-PCR reaction, we quantified the concentration of RNA accurately using spectrophotometry. cDNA was synthesized from DNase-treated total RNA using the Reverse Transcription System Kit (Promega, Madison, WI) and oligo-dT primers. Control reactions were performed using 18S RNA (5’-TTCTGTCGGCGATGCGCTCC-3’ and 5’-GCCTCAAACTTCCGCGGCCT-3’) to ensure that equal amounts of RNA were used in each set of reactions. We optimized the cycle numbers to ensure that the amplification reaction was tested during the exponential phase. The following specific primers were designed: AcGH3.3 (HO089067): 5’- AGCTGATGCACTCTCAATCGCGC -3’ and 5’- ACTCGACGACACCTCGGCCA -3’; AcTIP1 (HO089154): 5’- TGGAGCTGGAACAACCACTGGGT -3’ and 5’- AGTGACGATTATGAAAGACGACCC -3’; AcSIHP1 (HO089134): 5’- CGAGGTACGCGGGGAAGCAA -3’ and 5’- GCCATTGCGGTGGTGGTGGA -3’; AcCAT1 (HO088747): 5’- CATGCCAGGGGAGCGAGTGC -3’ and 5’- CCCGGGGCAGGTACGCTTTG -3’; AcCAT2 (HO089037): 5’- AGCCTTGTCTGATCCACGCCTCA -3’ and 5’- GCCTGCTTGCTACTTTCATGCCCA -3’; AcEXP1 (HO088836): 5’-CCATGGCCGCGGGATTTCGA -3’ and 5’-CGGTGGATGGTGCAACCCTCC -3’.