Spencer Richardson and Dillon Gray

Richardson 1

Fall 08

Cloning of DMC1from Tetrahymena

Spencer Richardson and Dillon Gray

Dr. Smith

Fall 08

Abstract

DMC1 is a meiosis specific RAD51 homolog required for recombination repair of meiotic double strand breaks.1 The widely conserved DMC1 has a critical role in meiosis in most sexual organisms, but what its molecular functions are and how and why it differs from its cousin RAD51 are not well understood.2The goal of our experiment is to discover genes in Tetrahymena that contain homologs of another disease causing gene that has been found in other organisms. In the experiment, we will be using different techniques to achieve our final goal of the plasmid. By putting our gene, DMC1on a plasmid, will allow us to store the plasmid for late use by other scientist around the world. By, storing DMC1 on a plasmid it will allow further study of the role of the gene and better understand what the DMC1 does in the cell and in the body. The long term goal of this project is to see how DMC1 actually affects the cell and to confirm its role in meiosis.

Introduction

Our experiment is a 7 week long study where we will try to clone a gene from the ciliate Tetrahymena into a plasmid that will then have the ability to be used by other researchers around the world in their research. We are first looking for homologs in Tetrahymena of the gene Mus musculisDMC1. Once found we then isolated the Tetrahymena genomic DNA, to get it ready for PCR. “Polymerase chain reaction (PCR) enables researchers to produce millions of copies of a specific DNA sequence in approximately two hours. This automated process bypasses the need to use bacteria for amplifying DNA.”3DMC1 is a necessary part of meiosis-specific recombination and is a paralog of RAD51. Like RAD51 recombinant human DMC1 protein forms octameric rings that are capable of binding DNA and forming helical nucleoprotein filaments that catalyze strand exchange.4 DMC1 has a critical role in meiosis in most sexual organisms, but how and why it differs from its cousin RAD51 are not well understood.2DMC1 exchange uses a special pathway of homologous recombination that repairs DNA double-strand breaks, basically, the cell deliberately damages its own DNA and then uses the repair process to lock homologous chromosomes together.2 We are going to continue to work with DMC1 and get a better understanding of how it is related to RAD51.

Methods and Procedure

Bioinformatics: Molecular Computational Tools

We started out locating the amino acid sequence of Mus musculis DMC1 at We then used the sequence that best described our protein and entered it in to the Tetrahymena Genome Database at After finding the homolog’s we used the Tetrahymena Genome database again to find the protein sequence. We also located the NST and ESTs. After determining all the information we determined if out proteins stop and start introns were predicted. Finally we compared our protein sequence to our homolog. Complete protocol can be found in BMS 110 Honors Lab 3, fall 2008.

Tetrahymena Genomic DNA Isolation

First we started off the procedure by pipeting about 1.4mL of Tetrahymena culture into a micro centrifuge tube. After swirling we collected the cells by centrifugation for 1 minute at 10,000rpms. We quickly poured off the supernatant, which is the clear liquid that lies above a sediment or precipitate5, then proceeded by adding 700µl of lysis buffer and pipeted up and down to mix and re-suspend the cells. After we phenol-extracted the lysate, by adding 600µL of a 1:1 phenol: choloroform mix. We then gently shook the tube to mix the phenol through entire tube.We then centrifuged the mixture for 5 minutes at maximum speed. After the centrifuging process we transferred the top layer to a new tube using a pipette. We then repeated the phenol extraction one more time to fully make sure we did everything correct. After words we added 150µl of 5M NaCl to the extracted lysate, and then precipitated the DNA by adding an equal volume of isopropyl alcohol to the lysate, inverting the lysate-alcohol mixture 10 times, and allowing the mixture to stand for 10 minutes. We then centrifuged the mixture on maximum speed for 5 minutes before decanting the supernatant into a collection beaker and adding 500µL of 70% ethanol. We then centrifuged the precipitate for 3 minutes at maximum speed removing the supernatant once complete. Once dry we then added 50µL of Tris-EDTA buffer, and gently pipetting up and down to re-suspend the pellet and then proceeded to put the sample on ice. Finally we added 1µL of RNase a (10mg/mL stock) and incubated at 37ᵒC for 10 minutes. We then prepared dilutions of DNA. I made the 1:200 dilution using 1µL of DNA and 199µL H20, while Dillon prepared the 1:100 dilution. We then put our dilutions into the spectrometer and got the readings for A260 and A280. We used the A260 to find our concentration of our original stock DNA solution. Full protocol can be found in BMS 110 Honors Lab 4, fall 2008.

Polymerase Chain Reaction (PCR)

We set up 4 reactions, using a master mix allowing for one extra reaction in case of error while pipeting. We pipeted 1.8µL of genomic DNA, 1.25µL of TF primer and TR primer, .5µL phusion polymerase, 10µL HF buffer, 1µL of .2mM dNTPs, and 35.82µL of sterile distilled water into each tube or 50µL of the master mix for the reaction. Then I put two genomic DNA templates into 58.4ᵒC bath and a 50.0ᵒC baths in the thermo cycler for 34 cycles. Dillon put his two genomic templates in the baths at 59.55ᵒC and 60.7ᵒC. The Tf Primer was 5’- CAC CCT CGA GAA CGA TTG TTA CTC TGA TAA AGA AG- 3’. The TR primer was 5’-CCT AGG TCA ACC AGT AGA AGG CTT TTT ATC -3’. Complete protocol can be found in BMS 110 Honors Lab 5, fall 2008.

Agarose Gel Electrophoresis

Our lab instructor had our agarose gels prepared for us when we got to class. After the gel was set, we took the casting tray out from pouring position and placed so the wells are oriented so the PCR samples run down the gel. We then covered the gel with 1X TAE until it just covered the gel and there was no longer a glare coming off the gel. After, we removed the comb from the gel to begin the process of loading the gel. For loading the gel we first added 1µL of 10X sample dye onto a piece of parafilm for each PCR tube, and then we loaded 5µL of 1 kb ladder to the first lane. We then pippeted 10µL of our sample on to the dot of 10X dye. We then loaded it on the gel in the lanes next to the ladder. After the samples where in the gel, we setup the power supply to run at 90 volts for just under 1 hour and 15 minutes. We then took the gel to the UV light box and took pictures of the gel.Complete protocol can be found in BMS110 Honors lab 6, fall 2008.

PCR Product Cleanup and Cloning

We started by using Dr. Smiths PCR reaction because ours did not produce product. We then pipette 320µl of distilled water into the sample reservoir, before adding 40µL of each of Dr. Smiths PCR reactions 1 and 2. We then centrifuged the Montage PCR for 15 minutes and then placed the reservoir in a clean vial, to add 20µL of distilled water. We then inverted the reservoir into another clean vial and centrifuged for 2 minutes. We then made a 1:50 dilution and ran them through the spectrophotometer at A260 and A 280 to determine the DNA concentration. After determining our concentration we created new solutions adding components to Dr. Smith’s two PCR reactions and also created a negative control. The first solution we used 1.4µL PCR product, 1.0µL salt solution, 2.6µL sterile water and 1.0µL TOPO vector. The second solution was created by taking .5µL PCR, 1.0µL salt solution, 2.5µL sterile water, and 1.0µL TOPO vector. The negative solution was made by not adding any PCR, 1.0µL salt solution, 4.0µL sterile water, and 1.0µL TOPO vector. We mixed the reactions by gently pipeting then incubating for at least ten minutes at room temperature. We then took thawed E. Coli vials, and added 2µL of the TOPO cloning reaction, and incubated for 10 minutes. After incubating we used heat shock for 30 seconds, and immediately put them back on ice. We then added 250µL of SOC medium, and transfer the tube to the shaking incubator set at 37ᵒC for 1 hour, laying them horizontally. After taking the tubes out of the incubator we spread 200µLto a plate containing 50µg/mL kanamycin, then incubating overnight at 37ᵒC. Full protocol can be found in BMS 110 lab 7, Fall 2008.

Construction of Plasmid Map

We first started off the lab by selecting the sequence from the PCR reaction including the primer sequence, and entered it into the TOPO-D plasmid using Gene Construction Kit 3.0. We first started by deleting the junction markers, and then changed the colors of our gene sequence and introns. Later we marked all the restriction sites that correspond to a list of commonly used restriction enzymes in lab. We entered in all the restriction enzymes and then determined that BGLII would be the best enzyme digest, to confirm we have our gene in the plasmid. We then changed the view to determine how many bands our gene should produce. Full protocol can be found in BMS 110 Honors lab 8, Fall 2008.

Plasmid Purification

The day before the lab we prepared by adding 6ml of LB with 50µg/ml Kanamycin in three glass tubes, one for each colony. We then took a new LB/KAN plate and gridded it and numbered it 1-6. We then took a 6-inch sterilized wooden stick and picked up a colony from our cloning transformation plate and placing it on the corresponding number on the grid. After transferring swirled the stick around in liquid LB/KAN, and then put our test tubes in 37ᵒ C shaking incubator overnight. After a night of incubation we labeled 3 tubes for each culture ex. 1a, 1b, 1c, 2a… 9 totals.We then started pipeting around 1.4mL culture into each of the three tubes with the corresponding numbers. Once all 9 tubes are full we centrifuged for 3 minutes. We then poured off supernatant and then added 250µL Buffer P1 into the 1a, 2a and 3a tubes. For each culture we re-suspended the pellet by pipetting up and down slowly, then transferring it into the second tube to re-suspend, and transferring to third tube to completely re-suspend. We then added 250µL Buffer P2 and inverted the tubes to make them blue making sure there was no white precipitate. Soon after it turns completely blue we added 350µL Buffer N3 to turn the solution back to a clear liquid, followed by centrifuging from 10 minutes. We then put the supernatant into a QIAprep spin column, and centrifuged for 1 minute then discarding the flow through. We then added 500µL Buffer PB to the column and centrifuged for 1 minute, discarding the flow through. We then added 750µL Buffer PE and centrifuged for 1 minute discarding the flow through and centrifuged an additional 1 minute. We then placed the column in a new 1.5 mL tube and added 50 µL Elution Buffer and let stand for 2 minutes before centrifuging for 1 minute, followed by discarding the column. We then placed the tubes on ice and stored them at -20ᵒC. We then determined our restriction buffer and made a cocktail for digest using 2 µL of 10X buffer 0.5 µL BAGLIIand 15.5 µL water. We made then multiplied the cocktail 7 times to give us our desired amount. We proceeded by putting 18µL of the cocktail in tubes, followed by adding 2 µL of each plasmid to its appropriate tube and mixed by pipetting. We then incubated for 37ᵒ C for 1 hour. Complete protocol can be found in BMS 110 lab 9, Fall 2008.

Results

T.t. DMC1 Genomic = 1366 bp & cDNA = 1163 or 1084 bp

caccctcgagaacgattgttactctgataaagaagataatgaagaataaaactaaattgctcaagaagagatctttttagtagaaatgcttgcaactgagggagttaacaataatgaaatacaaaagcttaaaaaggtatgtagttgttatattaattcacaataagacaatatcattgattatataaaaataaatataaagaatggaatcctttcactcaaatctttagttatgaacacaaagagggatcttgttaatatctatggaattcctgataataaagctgattcatatgtcaaaaaagcttcagaaatattagctcgatctgaaaacagcaggttattcagcagtgagtttgttctcggtactactgtactataaagaaggagttaaataagaagaatatcaacaggatccaaggctttagatgatatattgaatgggggaatagagtctcaaagcataacagaattttatggagaatatcgttcaggcaaaacataaatagctcatactgcatgcgttctggctcaatcttaagatcattgctaaagtaaaacaagcataagaaattttaactggttttaaataaattattctgcttaaatatagccatttaaataaaaaaataggtccaggaaaagttttatacattgatactgaaggaaccttcagacctgaaagaatatgctaaatagcttcgcactacggaatggagggtgaatatgccctaagtaatataatttatgggagagcctataacgtagattaataaaacacattgcttattaaaggagcccaattaatggtagaggaaaattgttttgctctactagttgttgattcaataatggctaattttagatgcgatttttctggaagaggagatctctctgaaagacaataagcacttggcaagtttatgagcagattataaagaatggctgctgaatttaatatcgcagtggtaaataaatacattctttattttatcaacacctttctgcttttatacgattcttattcttaaaattaacaaacagattataacaaactaagttatggctgatccaagtggagccatgactggaggcgctataccctagcccaagccaattggaggccatattttagcccatgcatcgacatagcgcttattcatgaagaagaaaactgataacatccgtaaagtaaagtaaaacaaaacaaaacttcttaaatcacaaataaaaaatttttctttcacttaattaaaggctggttgattcaccttatttgtaagataaagaagttgatattatggttagcgacagaggagtaggagatgttgaatgtgataaaaagccttctactggttgacctagg

Figure 1. . Shows the genomic DNA sequence of Tetrahymena DMC1. The Red indicates the sequence that is present in the mature RNA and the black is the sequence removed (introns). The yellow shaded sequence corresponds to the sequence of the primers used to amplify the gene using PCR and the underlined portion corresponds to EST’s delteted.

Mus muscalus DMC1 / 340 / TTHERM_00142330 (6.2E-76) RAD51 / TTHERM_00459230 (5.2E-57) DMC1
A260 / A280
1.112 / .549

Table 1. Shows our Gene DMC1and the amount of amino acids in our protein alone with the two strongest homolog’s

Figure1 and Table 1 were done in order to discover the homolog of MUS DMC1. We will now use this information to determine which sequence we need to isolate. Without finding the homolog we would not be able to even start our experiment.

. Table 2. Shows our results from the spectrometer, at wave lengths of 260 and 280.

DNA Concentration 5.56µg/µL / DNA purity 2.0255µg/µL

Table 3. Shows the DNA concentration and Purity by using the information from table 2.

After finding the gene homolog, we isolated the DNA to find the wave lengths, concentration and purity. The purity of the DNA looks pretty pure, which will hopefully give us good PCR product.

Ladder 1 2 3 4

Figure 2 .1% Agarose Gel. Lane 1 had an annealing temperature of 59.55ᵒC. Lane 2 had an annealing temperature of 60.7ᵒC. Lane 3 had annealing temperature of 58.4ᵒC. Lane 4 had an annealing temperature of 50.0ᵒC. We received no product in our experiment.

After running the gel (figure 2) we found little to no results in the gel. We will use this information to clean up the PCR product, from Dr. Smith in hopes of getting better results and allow us to produce a plasmid that other scientist can use.

A260 / .028
A280 / .018

Table 4. Shows the results of the clean PCR reaction in the spectrometer.

Clean PCR concentration= .07µg/µL / Clean PCR purity = 1.55

Table 5. Shows the results of the clean PCR’s concentration and purity. Found using data in table 4.

After cleaning up the PCR our purity decreased to 1.55 which is not as high as our initial purity but closer to the desired purity level of 1.7 to 2. We will continue through the experiment using the newly cleaned up PCR product with the purity sitting at 1.55

We had 26 colonies on our 200µl #1 plate
Negative control plate had 16 colonies

Table 6 gives our results on our plates after cleaning up the PCR product.

Figure 3. Is a plasmid map showing all of the restriction enzymes. We used BglII as our restriction enzyme.

The plasmid map in figure 3 shows our sequence along with introns. The map is used to determine which restriction enzyme is needed to complete our experiment. This map will helps us find the best enzyme.

Table 7 Shows the band size that Lab 7 predicted would come out of the Gene sequence when using BglII restriction enzyme.

Buffer:3 BSA: none Restriction Enzyme: BglII

Incubation Temp.: 37ᵒC Predicted Band Size on Gel: 3124 & 818

Table 8 shows the measures taken before we ran the restriction enzyme digest gel.

Figure 4 shows the bands of our gene sequence with the restriction enzyme BglII in a 1% agarose gel.

Table 7 and figure 4 Table 7 shows the predicted base pairs for BglII in our gene. Our predicted band sizes were 3124 and 818. Our gel shows most wells had a band around 3124 but zero bands at 818. It actually appears there are bands higher than 3124, which is not supposed to happen. With these results, we will have to look back in the experiment to change it and improve our results.

Discussion

Through the experiment we learned a lot about ourselves and DMC1. I felt bio-formatics was the most important part of the experiment, because if we messed up and didn’t find the correct homolog or made an error when determining the introns, it could have messed our experiment up before we really even started. Lab 4 was useful in being able to isolate the DNA and allow it to be used later.I believe that the polymerase chain reaction lab is where our troubles first came up. What actually happened is unknown right now. Up until lab 5 everything was running good, or so we thought. We actually found out we had a problem when we ran our first agarose gel. The gel showed that our PCR produced very few, if any base pairsin the UV picture. We are unsure of why this happened, either error by one of us, or a weak primer sent to us by IDT. Using Dr. Smith’s PCR gave us a little more evidence that it was IDT’s fault by giving us weak primers, but it does not completely rule out contamination earlier on in the experiment or other error. In hopes of returning better results we cleaned up the PCR products and cloned our PCR. The cleaning of the PCR product did not show any more favorable results.Using the plasmid map and mock gel allowed us to check the accuracy of our experiment by giving us the base pairs that should be shown.Purifying the plasmid was supposed to give us the results that the plasmid map said we should get.Unfortunately the purification process did not work exactly like we wanted. Getting very little bands showed that our experiment encountered problems throughout the way. In future experiments, maybe a stronger primer would help the experiment get better results. Some of the procedure might need a little re-working also, to see what works better. Changes that need to be made to the overall experiment would be more careful technique when pipetting, a better environmentally controlled location, and more time to fully focus on the lab instead of trying to rush through. Overall the experiment was a great learning tool, and experience. I have a better understanding of techniques used to clone Tetrahymena genes.We also learned the complicated process of getting genomic material and putting it into a plasmid for use by later scientist.DMC1 needs to continue to be worked on to fully understand the function it has in meiosis.

References

1.Bannister, Laura A., Roberto J. Pezza, Janet R. Donaldson, Dirk G. De Rooij, Kerry J. Schimenti, R. Daniel Camerini-Otero, and John C. Schimenti. "A Dominant, Recombination- Defective Allele of DMC1 Causing Male-Specific Sterility." Plos Biology may 5 (2007): 1016-025.