SUPPLEMENTARY INFORMATION
METHODS
Plant Materials
Leaf and floral tissue from Ipomoea quamoclit were collected from a population of this species near Durham, North Carolina. Leaf and floral tissue from I. purpurea was obtained from inbred lines originally collected in Durham, North Carolina, and maintained in a greenhouse through 11 generations of selfing.
Pigment Identification
Total flavonoids were extracted from flowers by soaking corollas in 2N HCl for one hour, then boiling for one hour. Anthocyanidins were then extracted from the HCl with a few drops of iso-amyl alcohol. This extract was lyophilized, then resuspended in methanol with 1% HCl. Anthocyanidins were separated using thin-layer chromatography on cellulose-coated glass plates in forestal solvent (acetic acid: HCl: water, 30:3:10)1. Identities of anthocyanidins were determined by comparison with known standards.
Cloning of F3’h and Dfr-B
The sequence of Dfr-B from I. purpurea has previously been reported2. The sequence of I. purpurea F3’h was supplied by S. Iida3. Primers based on these sequences (Table S1) were designed and used to amplify full-length cDNA clones of these genes from I. purpurea and I. quamoclit floral bud tissue using rt-PCR. The PCR protocol used consisted of 35 cycles of the regime 95°C for 30 sec., 50 °C for 1 min. 30 sec., 70°C for1 min., followed by a 7 min. extension at 72°C. PCR products were cloned (TA-cloning kit, Invitrogen) and sequenced for verification. Genes were subsequently sub-cloned into the vector pBI 1.4t containing the constitutive CaMV 35S promoter and Kanamycin and Gentamycin resistance for complementation analysis. Sequences of the I. quamoclit genes have been deposited in GenBank (Accession No. AY463156 and AY463157).
Complementation Analyses
To determine whether F3’h and Dfr from both species are functional in vivo, we employed the complementation analysis described by4. In this analysis, the gene whose function is to be assessed is transformed into a strain of Arabidopsis thaliana that is doubly homozygous for a knockout mutant of the native gene. Normally, A. thaliana produces copious anthocyanins in leaves when plants are stressed by germinating them on pure sand. The knockout mutants, however, fail to produce anthocyanins because the anthocyanin biosynthetic pathway is blocked. Transformations of functional genes from other, often taxonomically distant, species (e.g.. maize) restores anthocyanin production in the mutant strain4. Failure to restore anthocyanin production thus indicates non-functionality of the tested gene.
Mutant A. thaliana strains used were obtained from the Arabidopsis Biological Resource Center (Ohio State University) and carried a single Transparent testa (tt) mutant in homozygous form: either tt7-1, a knockout of F3’h, or tt3-1, a knockout of Dfr. Genes in the vector pBI 1.4t (described above) were transformed into the Agrobacterium tumefasciens strain GV3101 using a freeze-thaw protocol5. The genes were then transformed into the appropriate A. thaliana mutant strain using the standard dip protocol6. Transformants were selected by growing on MS medium containing 50mg/l Kanamycin. Four to eight T1 plants that carried Kanamycin resistance were transferred to soil and allowed to self-fertilize to produce T2 plants. Anthocyanin phenotypes of T2 plants were scored by germinating seeds in sand under high light; the anthocyanins were then extracted as above from the first true leaves and run out on TLC plates. To confirm success of transformations, T2 plants were transplanted to soil and allowed to mature. DNA was extracted and scored for the presence of the transgene by PCR-cloning, followed by sequencing. In addition, RNA was extracted from seedlings grown in sand under high light and rt-PCR was performed to confirm expression of the transgene.
Enzyme Assays
To determine whether F3’h and Dfr are functional in vitro, the protein products of these genes were tested for catalytic activity in enzyme assays. Clones of each gene from both I. purpurea and I. quamoclit in the pBI 1.4t vector were grown and expressed in E. coli. Cultures were grown in LB broth with 50 mg/l Kanamycin at 37°C and expression was induced with 200µl of 1M IPTG. When cell density reached OD600 = 1, the cells were collected by centrifugation and resuspended in 100 ml 1M HEPES buffer. Proteins were extracted from cell culture by disruption in 100-200 ml HEPES buffer with 10 ml of 100 mg/ml lysozyme for 30 min. on ice. Because F3’H is a membrane-associated protein, whereas DFR is soluble, assays were run using the total extract for F3’H assays, but using the supernatant after centrifugation (15000 rpm for 20 min. at 0°C) for DFR assays.
F3’H activity was measured using a protocol modified from7,8. 200 ml of homogenized, lysed cells were combined with 0.1M Tris (pH 7.4) solution, 1 mmol NADPH, 6 mmol glucose-6-phosphate, 1 unit of glucose-6-phosphate dehydrogenase, and 1 mmol of the substrate dihydrokaempferol (DHK), dissolved in ethanol, for a final reaction volume of 1 ml. The reaction was incubated for 90 minutes at 30°C and immediately extracted twice with 1 ml of ethyl acetate. Products were separated using thin layer chromatography on cellulose-coated glass plates using a chloroform: acetic acid: water (10:9:1) solvent and visualized under UV light. Spots that cosegregated with the reaction product dihydroquercitin (DHQ) were scraped off the plates and dissolved in 100% ethanol. The absorbance of these solutions was measured at a wavelength of 289 nm, which corresponds to the major absorbance peak of DHQ. Reactions with an empty vector were run as controls. Three reactions of each type were run.
DFR activity was assayed using the method of8. This is an assay of the ability of DFR to convert dihydroflavonols to leucoanthocyanidins. Leucoanthocyanidins are subsequently non-enzymatically converted to visible anthocyanidins, the absorbance of which is measured. 1 ml reactions with 200 ml of the DFR protein preparation, or empty vector, were incubated with in 0.1 M Tris (pH 7.4) containing either 1 µmol of either DHQ, DHK, or no substrate for 20 minutes at 30°C. Amount of product produced was quantified by measuring absorbance at 535 nm for cyanidin (DHQ as substrate) or 520 nm for pelargonidin (DHK as substrate). Seven reactions of each type were run.
F3’h Expression Assays
To determine the expression levels of F3’h and Dfr, relative to other anthocyanin structural genes, DNA slot blots were constructed using a Bio-Dot SF Microfiltration Apparatus (Bio-Rad) following the manufacturer’s instructions. Genes spotted were: chalcone synthase (Chs-D) from I. purpurea; chalcone isomerase (Chi) from I. purpurea; flavonone 3-hydroxylase (F3h) from I. purpurea; dihydroflavonol reductase (Dfr-B) from I. purpurea and I. quamoclit; anthocyanidin synthase (Ans) from I. purpurea and I. quamoclit; UDP-glucose flavonoid 3-glucosyltransferase (Uf3gt) from I. purpurea; and flavonoid 3’-hydroxylase (F3’h) from I. purpurea and I. quamoclit. 100 ng of each gene was spotted onto a Zeta-Probe membrane (Bio-Rad) and fixed by exposure to UV light. The spotted genes were obtained by PCR from cDNA of the appropriate species, and were full-length copies for all genes except Chs-D and Dfr-B from I. purpurea. For Chs-D, the second of two exons, representing 989 of the 1167 bp of the coding region was spotted; for Dfr-B, 990 bp from the 3’ end of the coding sequence, out of a total coding region of 1163 bp, were spotted.
cDNA Probes were constructed from total RNA extracted from bud tips (the distal half of the bud) of I. purpurea and I. quamoclit that were 1 day before opening. 5 mg of RNA was reverse-transcribed using M_MLV reverse transcriptase (Invitrogen) and oligo(dT)15 as a primer in a reaction mixture containing 32P dCTP. Unincorporated nucleotides were separated from the labled cDNA using ProbeQuant G-50 Micro Columns (Amersham). Membranes were probed overnight at 65°C and washed according to the manufacturer’s instructions. The probe signal was captured and visualized using a phosphorimager (Molecular Dynamics).
Phylogenetic Analysis
A phylogeny of 13 Ipomoea species (including those species shown in Fig. 1 plus I. cairica and I. sepiaria as outgroups) was determined based on sequence of the internal transcribed spacers of nuclear ribosomal DNA (ITS). ITS sequences were obtained from Refs.9-11. A maximum likelihood analysis based on the HKY85+G model was performed in PAUP* version 4.0b1012. Branch support was estimated with 100 bootstrap replicates.
______
1. Harbourne, J.B. Comparative Biochemistry of the Flavonoids, (Academic Press, London, 1967).
2. P. Tiffin, Miller, R.E. & Rausher, M.D. Control of expression patterns of anthocyanin structural genes by two loci in the common morning glory. Genes Genet. Syst., 73, 105-110 (1998).
3. Hoshino, A. et al. Spontaneous mutations of the flavonoid 3’-hydroxylase gene conferring reddish flowers in the three morning glory species. Plant Cell Physiol., 44, 990-1001 (2003).
4. Dong, X., Braun, E.L. & Grotewold, E. Functional conservation of plant secondary metabolic enzymes revealed by complementation of Arabidopsis flavonoid mutants with maize genes. Plant Physiol., 127, 46-57 (2001).
5. An, G., Ebert, P.R., Mitra, A. & Ha, S.B. pp. A3: 1-19in Plant Molecular Biology Manual, ed. S. B. Gelvin and R. A. Schilperoort (Kluwer Academic Publishers, Dordrecht, 1988).
6. S.J. Clough, & Bent, A. F. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J., 16, 735-743.
7. Forkmann, G. & Ruhnau, B. Distinct substrate specificity of dihydroflavonols 4-reductase from flowers of Petunia hybrida. Z. Naturforsch., 42, 1146 (1987).
8. Stafford, H.A. & Lester, H. H. Enzymatic and nonenzymatic reduction of (+)-dihydroquercitin to its 3,4-diol. Plant Physiol., 70, 695-698 (1982).
9. Miller, R.E., Rausher, M.D. & Manos, P.S. Phylogenetic systematics of Ipomoea (Convolvulaceae) based on ITS and waxy sequences. Syst. Bot., 24, 209-227 (1999).
10. Manos, P.S., Miller, R.E. & Wilkin, P. Phylogenetic analysis of Ipomoea, Argyreia, Stictocardia, and Turbina suggests a generalized model of morphological evolution in morning glories. Systematic Botany, 26, 585-602 (2001).
11. Miller, R. E., McDonald, J. A. & Manos, P. S. Systematics of Ipomoea subgenus Quamoclit (Convolvulaceae) based on ITS sequence data and a Bayesian phylogenetic analysis. Am. J. Botany (in press).
12. Swofford, D.L. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4.0, (Sinuar Associates, Sunderland, Massachusetts, 2000).
Table S1. PCR primers used in obtaining full-length cDNA clones of F3’h from I. purpurea (P15-N4) and I. quamoclit (P15-P84) and Dfr from I. purpurea (DFR31-DFRVR2) and I. quamoclit (DFRIF-DFRIR).
P15 / AAGACCAAGTATGGCTACC
N4 / GGTCGAAAGCTAGACCTCTGTTTAAGTG
P84 / TTAATTGAGAGTATAGAGATG
DFR31 / CTTCGGTAGAAGCTTAGCTTATTGATCCG
DFRVR2 / GCTTGAGAAGCTAAGCACACTG
DFRIF / GATCCGAGGACATATGGTGGACGGTAATCATCC
DFRIR / CTGATACACCTATGGTGCCATGGTGTTGTAG
-8-