Online Resource

Table S1.Information on collection sites with geographic coordinates, the number of Lasioglossumspecimens collected, number of bees with successful COI amplification used in molecular analysis (in parentheses)and COI GenBank Accession numbers (Accession numbers are given for all unique haplotypes).Colours represent each of the regions in the Yucatan peninsula: purple, west; brown, centre; blue, east (see Fig. 1). We also show the putative taxonomic determination for each individual.

Region / Site / Latitude / Longitude / Number individuals / Genbank accession / BOLD BIN / mOTU / Specimen ID
Homún / 20° 43' 51.40" / -89° 15' 35.00" / 21 / KU574907 / ACT3294 / mOTU1 / 526
(10) / KU574944 / ABY5206 / mOTU5 / 505
KU574934 / ACS9355 / mOTU5 / 507
KU574939 / ABY5206 / mOTU5 / 511
KU574984 / ACE9632 / mOTU6 / 509
KU574997 / ACT0906 / mOTU8 / 509d
Muna / 20° 28' 15.70" / -89° 46' 53.50" / 36 / KU574883 / ACT3294 / mOTU1 / 569d
(7) / KU574920 / ACT2524 / mOTU4 / 550
KU574921 / ACT2524 / mOTU4 / 570
West / KU574955 / ABY5206 / mOTU5 / 570d
KU574937 / ABY5206 / mOTU5 / 553
Tekal de / 21° 1' 40.50" / -88° 58' 46.30" / 23 / KU574919 / ABY5206 / mOTU4 / 116
Venegas / (10) / KU574938 / ABY5206 / mOTU5 / 137
KU574972 / AAW9940 / mOTU6 / 117
KU574973 / AAW9940 / mOTU6 / 118
KU575004 / ACT3065 / mOTU8 / 120
KU575006 / ACT3066 / mOTU8 / 119
KU575008 / ABA1794 / mOTU9 / 140
Merida / 20° 58' 03.72" / 89° 35' 37.69" / 30 / KU574935 / ABZ7231 / mOTU3 / 622
(4) / KU574917 / ABZ7231 / mOTU3 / 626
KU574915 / ABY5206 / mOTU5 / 622
Alfonso / 20° 5' 2.50" / -89° 9' 39.30" / 43 / KU574923 / ACT2524 / mOTU4 / 110
Caso / (16) / KU574953 / ABY5206 / mOTU5 / 71
KU574996 / AAE1080 / mOTU8 / 76
KU574893 / ACT3294 / mOTU1 / 77
KU574914 / ABZ7231 / mOTU3 / 80
KU574909 / AAE1080 / mOTU2 / 81
KU574911 / AAE1080 / mOTU2 / 86
KU574985 / ACT3875 / mOTU7 / 89
KU574910 / AAE1080 / mOTU2 / 91
KU575001 / ACT1185 / mOTU8 / 93
Nenela1 / 20° 14' 44.10" / -89° 5' 52.60" / 68 / KU574886 / ACT3294 / mOTU1 / 65a
(23) / KU574963 / ACT1788 / mOTU6 / 34
KU574964 / ACT1789 / mOTU6 / 39
KU574965 / AAW9940 / mOTU6 / 44
KU574966 / AAW9940 / mOTU6 / 31
KU574967 / AAW9940 / mOTU6 / 63
KU574959 / AAW9940 / mOTU6 / 4
KU574971 / AAW9940 / mOTU6 / 70
KU574981 / AAW9940 / mOTU6 / 23
KU574988 / AAJ1797 / mOTU7 / 343
KU575005 / ACT3066 / mOTU8 / 12
KU574998 / ACT0906 / mOTU8 / 15
Nenela3 / 20° 20' 10.90" / -89° 1' 19.20 / 21 / KU574895 / ACT3294 / mOTU1 / 339
(7) / KU574900 / ACT3294 / mOTU1 / 342
KU574901 / ACT3294 / mOTU1 / 332
KU574956 / ABY5206 / mOTU5 / 342e
KU575003 / ACT3065 / mOTU8 / 341
Santa / 20° 23' 32.50" / -88° 55' 14.60" / 45 / KU574896 / ACT3294 / mOTU1 / 587
María / (7) / KU574906 / ACT3294 / mOTU1 / 590
KU574958 / ACS9636 / mOTU5 / 572
KU574926 / ACT3927 / mOTU6 / 581
Tah Dziú1 / 20° 10' 6.90" / -88° 55' 36.2" / 26
(7) / KU574881 / ACT4788 / mOTU1 / 240
KU574969 / AAW9940 / mOTU6 / 240a
KU574928 / ACT3930 / mOTU6 / 238
KU574993 / AAJ1797 / mOTU7 / 223
KU575000 / ACT3064 / mOTU8 / 239a1
Tah Dziú2 / 20° 12' 6.80" / -88° 57' 9.40" / 46 / KU574884 / ACT3294 / mOTU1 / 455
(7) / KU574903 / ACT3294 / mOTU1 / 473
KU574929 / ACT2524 / mOTU4 / 452
KU574943 / ABY5206 / mOTU5 / 471
KU574991 / AAJ1797 / mOTU7 / 440
Timul1 / 20° 18' 56.10" / -88° 55' 55.90" / 46 / KU574897 / ACT3294 / mOTU1 / 307
(20) / KU574899 / ACT3294 / mOTU1 / 298c
Centre / KU574916 / ABZ7231 / mOTU3 / 326d
KU574923 / ACT2524 / mOTU4 / 308
KU574952 / ABY5206 / mOTU5 / 286
KU574947 / ABY5206 / mOTU5 / 298c
KU574946 / ABY5206 / mOTU5 / 293
KU574970 / AAW9940 / mOTU6 / 280
KU574974 / AAW9940 / mOTU6 / 279
KU574978 / AAW9940 / mOTU6 / 312
KU574980 / AAW9940 / mOTU6 / 305
KU574986 / AAJ1797 / mOTU7 / 327c
KU575002 / ACT3064 / mOTU8 / 327a
KU575007 / ACT3064 / mOTU8 / 294
Tixcuytun1 / 20° 12' 21.80" / -89° 9' 17.50" / 30 / KU574885 / ACT3294 / mOTU1 / 433.2
(14) / KU574892 / ACT3294 / mOTU1 / 433.1
KU574898 / ACT3294 / mOTU1 / 249
KU574950 / ABY5206 / mOTU5 / 251
KU574949 / ABY5206 / mOTU5 / 249
KU574983 / ACE9632 / mOTU6 / 271
KU574968 / AAW9940 / mOTU6 / 259
KU574975 / AAW9940 / mOTU6 / 244
KU574927 / ACT3286 / mOTU6 / 277
Tixcuytun2 / 20° 12' 24.20" / -89° 12' 9.80" / 40 / KU574979 / AAW9940 / mOTU6 / 243
(6) / KU574904 / ACT3294 / mOTU1 / 432.2
KU574888 / ACT3294 / mOTU1 / 435
KU574918 / ABZ7231 / mOTU3 / 434
Tixcuytun3 / 20° 11' 25.30" / -89° 10' 29.30" / 44 / KU574880 / ACT3294 / mOTU1 / 489
(10) / KU574924 / ACT2524 / mOTU4 / 488
KU574957 / ABY5206 / mOTU5 / 492
KU574954 / ABY5206 / mOTU5 / 491
KU574945 / ABY5206 / mOTU5 / 490d
KU574977 / AAW9940 / mOTU6 / 493
KU574990 / AAJ1797 / mOTU7 / 493d
Tixmehuac2 / 20° 15' 52.40" / -89° 8' 58.10" / 14 / KU574933 / ACT2524 / mOTU4 / 410
(6) / KU574948 / ABY5206 / mOTU5 / 356
KU574942 / ACT1355 / mOTU5 / 346
KU574976 / AAW9940 / mOTU6 / 347
KU574992 / AAJ1797 / mOTU7 / 411
KU574989 / ACT2336 / mOTU7 / 403
2
(2) / KU692028 / ACZ3669 / Sphecodes spp. / 411c
Tixcacaltuyub / 20° 25' 3.10" / -88° 55' 51.50" / 15 / KU574922 / ACT2524 / mOTU4 / 502
(6) / KU574962 / ACT1788 / mOTU6 / 503d
KU574999 / ACT0905 / mOTU8 / 503
Xaya / 20° 16' 51.70" / -89° 11' 28.70" / 31 / KU574931 / ACT2524 / mOTU4 / 614
(4) / KU574941 / ABY5206 / mOTU5 / 616
KU574994 / ACT3067 / mOTU8 / 616b
Yaxcopil / 20° 4' 4.10" / -88° 54' 23.80" / 43 / KU574889 / ACT3294 / mOTU1 / 603a
(4) / KU574912 / AAE1080 / mOTU2 / 602
KU574936 / ABY5206 / mOTU5 / 606
Moctezuma / 21° 24' 46.2" / -87° 42' 05.7" / 20 / KU574891 / ACT3294 / mOTU1 / 153
(9) / KU574905 / ACT5279 / mOTU1 / 148
KU574908 / AAE1080 / mOTU2 / 159
KU574913 / ABZ7231 / mOTU3 / 154
KU574930 / ACT2524 / mOTU4 / 143
KU574987 / AAJ1797 / mOTU7 / 142
Rancho / 21° 18' 26.71" / - 87°46'29.60" / 34 / KU574882 / ACT3294 / mOTU1 / 213
Alegre / (13) / KU574890 / ACT3294 / mOTU1 / 192
East / KU574902 / ACT3294 / mOTU1 / 216
KU574932 / ACT2524 / mOTU4 / 194
KU574951 / ABY5206 / mOTU5 / 195
KU574940 / ABY5206 / mOTU5 / 219
KU574982 / ACE9632 / mOTU6 / 204
KU574960 / ACE9632 / mOTU6 / 196
KU574961 / ACE9632 / mOTU6 / 193
San Pedro / 21° 18' 4.9" / -87° 38' 24.8" / 25 / KU574894 / ACT3294 / mOTU1 / 173
Bacab / (3) / KU574995 / ACT0906 / mOTU8 / 185

1

Table S2. Microsatellite loci used in this study. The primer sequences, repeat motifs, ranges of fragment lengths, numbers of alleles (n alleles), observed and expected heterozygosity and the fixation index (Fis) are provided. We provide three columns with the information for the markers used for each of the lineages (mOTU1, mOTU7 and mOTUs). The letters in the name of the primers represent the species for which they were developed; LM=Lasioglossum malachurum, LHMS=Lasioglossum hemichalceumand Rub= Halictus rubicundus.

mOTU1 / mOTU7 / All mOTUs / Sequence 5' -3' / annealing temp o C / Genbank Accession No. / Repeat motif / Product length (bp) / range (bp) / n alleles / Ho / He / FIS
LM27 / X / X / F:AACGACGGAACAATTCTTC R:ACTTTTCCACGGATTTCC / 55 / G75809 / (CTT)8 / 122 / 106-138 / 12 / 0.55 / 0.58 / 0.08
LHMS05 / X / F:CGGTGGTTGGAAAAACTA R:GGACGCTTCAGATTCAAG / 50 / AF454678 / (CT)21 / 120 / 100-150 / 11 / 0.05 / 0.14 / 0.65
LHMS10 / X / X / F:GGGAGGGAGAACCAAATG R:CAGCATCGCCAGAAAAAC / 50 / AF454680 / (GA)12 / 82 / 68-88 / 12 / 0.86 / 0.64 / -0.35
LHMS14 / X / X / F:CTTGTTTCCGCTCGTCTATA R:GAAGTCGTTACAGAACCACTGA / 50 / AF454683 / (AC)14 / 163 / 146-186 / 22 / 0.52 / 0.64 / 0.16
Rub02 / X / X / F:CCAGCCGGCCAACGTTGC R:CGGAGCTGAAAACTCAATTACAG / 55 / BV729095 / (GA)17 / 170 / 172-190 / 16 / 0.79 / 0.85 / 0.07
Rub35 / X / F:GATGACGCAGTACGAACGG R:GCTTCGACGTATGATTATCC / 55 / BV729108 / (GA)21 / 159 / 152-166 / 8 / 0.82 / 0.85 / 0.04
Rub55 / X / X / X / F:GCTATAAAAGGCGAAACGGGTG R:CTCCTATCCGGTTGACATTGCC / 55 / BV729100 / (GA)9 / 139 / 112-158 / 16 / 0.68 / 0.84 / 0.20
Rub59 / X / X / F:GTGACCAGGTGCGCTCGTTAC R:CCGTGTCCCCAGCTCCGTTTC / 55 / BV729101 / (GA)20 / 176 / 166-220 / 12 / 0.76 / 0.61 / -0.25
Rub60 / X / X / X / F:GCAAACACACCGCTAATGACATG R:GCCGACAGGTTTGCAGCATGAG / 55 / BV729102 / (CT)11 / 130 / 120-136 / 12 / 0.66 / 0.71 / 0.07
Rub61 / X / X / F:GACGCGGAAATAGAAAAGTTG R:CTAATGCATCGGGCCAACTG / 55 / BV729103 / (CT)12 / 192 / 180-202 / 17 / 0.73 / 0.72 / 0.01
Rub72 / X / F:GCATTTATTCCGTCGCGACTC R:CGGTGGCGGGGCTCGTAATG / 55 / BV729104 / (CT)20 / 146 / 140-154 / 8 / 0.78 / 0.59 / -0.32
Rub73 / X / X / F:GCTTTGTTTCTCACTATCGTCCC R:CGCGCAAAGTTCCCAGGGGTG / 60 / BV729105 / (CT)10 / 124 / 102-146 / 18 / 0.75 / 0.81 / 0.08
Rub77 / X / X / F:GGCCCTTCCGTCACGCGAC R:GAATCCATCCTCACGTGCAACC / 55 / BV729106 / (CTT)5 / 145 / 130-156 / 8 / 0.52 / 0.539 / 0.04

1

Table S3. Description of the coding of the morphological characters used in Table S4. The green colour represents the characters that appeared to be important for the separation of the lineages, and red colour representsthe characters that were considered to be non-independent and therefore one of these characters was retained and the rest were eliminated for the morphological analysis.

Morphological character / Character description
1 / Proportion of the superior half divided by the inferior half of the tegula / 1=tegula circular / <1=tegula ovoid, superior part smaller
2 / Angle of tegula / 0 =weak posterior angle / 1 = strong posterior angle
3 / Length of tegula / <300 µM=short tegula / >300 µM= long tegula
4 / Width of tegula / <250µM=narrow tegula / >250µM= wide tegula
5 / Punctation ratio in scutum (ratio) / <1000nM= narrow / >1000nM= wide
6 / Mesoscutal punctation density lateral of parapsidal lines (i<d = 1) or (i>1.5d= 1.5 or more) / (i<d = 1) = dense / (i>1.5d= 1.5 or more)=sparse
7 / Mesoscutal punctation lateradof parapsidal line ratio / 0=fine / 1= intermediate state between fine and coarse / 3= coarse
8 / Mesoscutum dull due to tessellate microsculpture; / 0=fine / 1=intermedian / 2=coarse
9 / Separation of propodeum / 0= more than two third / 1=less than two third
10 / Mesepisternum with or without punctation / 0=without punctures / 1=with punctures
11 / Mesepisternum decoration / 0=rugulose to tessellate / 1= strongly rugose
12 / Mesepistermun punctation / 0=no punctures or slightly punctuated / 1= punctuation oscuring the the metasomal terga
13 / Width of parapsidal line / 0 = very wide parapsidal line / 1= narrow parapsidal line
14 / Percentage of variable sculpture reaching more than halfway to posterior slope of metapostnotum / 0= reaching more than halfway to posterior margin / 1=halfway to posterior margin
15 / Metapostnotum with posterior margin distinctly convex, projecting beyond dorsolateral / 0= projecting beyond dorsoventral slope of propodeum / 1=not projecting beyond dorsoventral slope of propodeum
16 / Percentage of propodeal triangle with sculpture from base to apex / 0=with sculpture / 1=without sculpture
17 / Form of propodeal triangle / 0=anastomosingly rugose / 1=anastomosing / 2=rugose / 3=striate / 4=reticulate / 5=anastomosing with strong fan
18 / Strong carina present / 0=strong / 1=ausent
19 / Angle of lower gena area produced ventrally into a strong lateral acute angle or normal / 0=produced ventrally into a strong lateral acute angle / 1=normally angulate or rounded
20 / Mesepisternum rugulose to tessellate or strongly rugose / 0=rugulose to tessellate / 1=strongly rugose
21 / Colour of wings and veins / 0=transparent / 1=yellow / 2=white / 3=brown / 4=beige / 5=orange
22 / Supraclypeal area weak or strong convex / 0=Weakly convex / 1=strongly convex
23 / Dorsal margin of mandible strongly or not strongly curved / 0=not strongly curved at midlength / 1=strongly curved at midlength
24 / Ratio head size round / <1=elongated / >1=round
25 / Ratio head size long / <1= short / >1= long
26 / Ratio of punctures in supraclypeal area / <1=densely punctate / >1=sparsely punctuate
27 / Punctures in lower paraocular area / <1= dense puntures / >1=relative sparse
28 / Metatibial spur pectinate or serrate / 0=pectinate / 1=serrate
29 / Metatibial spur round or spatulate / 0=round / 1=spatulate
30 / Number of teeth in the spur / diverse number from 2-5

1

Table S4. Table of morphological characters measured to determine phenotypic differentiation of mOTUs;provided are means, standard deviations and ranges for all mOTUs.The green colour represents the characters that appeared to be important for the separation of the lineages, and red colour represents the characters that were considered to be non-independent and therefore one of these characters was retained and the rest were eliminated for the morphological analysis.

mOTU1 / mOTU2 / mOTU3 / mOTU4 / mOTU5
Morphological character / mean / SD / range / mean / SD / range / mean / SD / range / mean / SD / range / mean / SD / range
1 / Proportion of the superior half divided by the inferior half of the tegula / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.94 / 0.01 / 0.93-1.00 / 0.85 / 0.00 / 0.85-0.86
2 / Angle of tegula / 1.00 / 0.00 / - / 0 / 0.0 / - / 1.0 / 0.0 / - / 0.0 / 0.00 / - / 0.00 / 0.00 / -
3 / Width of tegula / 511.33 / 42.70 / 452.80-550.70 / 494.00 / 21.31 / 463.86-509.00 / 525.44 / 41.08 / 467.34-554.00 / 259.68 / 0.00 / - / 414.23 / 28.02 / 383.87-451.34
4 / Length of tegula / 327.16 / 27.94 / 289.50-362.25 / 324.42 / 12.19 / 307.18-333.00 / 286.29 / 12.06 / 277.76-303.00 / 184.83 / 0.00 / - / 236.86 / 20.61 / 214.53-264.15
5 / Punctation ratio in scutum / 808.13 / 93.48 / 602.72-965.81 / 1078.11 / 32.14 / 1033.96-1116.40 / 1572.65 / 55.49 / 1520.53-1663.80 / 1396.48 / 68.45 / 1292.00-1474.00 / 1392.10 / 75.59 / 1292-1474
6 / Mesoscutal punctation density lateral of parapsidal lines (i<d = 1) or i>1.5d= 1.5 or more / 1.50 / 0.00 / - / 1.25 / 0.25 / 1.00-1.50 / 1.50 / 0.00 / - / 1.00 / 0.00 / - / 1.05 / 0.15 / 1.00-1.5
7 / Mesoscutal punctation of parapsidal line ratio (um) / 0.00 / 0.00 / - / 2.00 / 0.00 / - / 3.00 / 0.00 / - / 0.00 / 0.00 / - / 0.10 / 0.30 / 0.00-1.00
8 / Mesoscutum dull due to tessellate microsculture / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 1.00 / 0.00 / -
9 / Separation of propodeum (mm) / 1.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 1.00 / 0.00 / - / 0.00 / 0.00 / -
10 / Mesepisternum with or without punctation / 0.55 / 0.48 / 0.00-1.00 / 0.33 / 0.47 / 0.00-1.00 / 0.67 / 0.47 / 0.00-1.00 / 0.00 / 0.00 / - / 0.10 / 0.30 / 0.00-1.00
11 / Mesepisternum with punctation / 1.00 / 0.00 / - / 0.00 / 0.00 / - / 1.00 / 0.00 / - / 0.00 / 0.00 / - / 3.00 / 0.00 / -
12 / Mesepistermun punctation: reticulate, interspaces imbricate or strong reticulate / 0.00 / 0.00 / - / 2.00 / 0.00 / - / 2.00 / 0.00 / - / 2.00 / 0.00 / - / 2.00 / 0.00 / -
13 / Width of parapsidal line (um) / 0.36 / 0.46 / 0.00-1.00 / 0.83 / 0.37 / 0.00-1.00 / 0.44 / 0.50 / 0.00-1.00 / 0.00 / 0.00 / - / 0.00 / 0.00 / -
14 / Percentage of variable sculpture reaching more than halfway to posterior slope of metapostnotum / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.25 / 0.43 / 0.00-1.00 / 1.00 / 0.00 / -
15 / Metapostnotum with posterior margin distinctly convex, projecting beyond dorsolateral / 0.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.10 / 0.30 / 0.00-1.00
16 / Percentage of propodeal triangle with sculpture from base to apex / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 2.00 / 0.00 / - / 1.00 / 0.00 / - / 0.00 / 0.00 / -
17 / Form of propodeal triangle / 2.00 / 0.00 / - / 0.00 / 0.00 / - / 1.00 / 0.00 / - / 3.00 / 0.00 / - / 1.00 / 0.00 / -
18 / Strong carina present / 0.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / -
19 / Angle of lower gena area produced ventrally into a strong lateral acute angle / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.75 / 0.43 / 0.00-1.00 / 1.00 / 0.00 / -
20 / Mesepisternum rugulose to tessellate or strongly rugose or not rugose / 0.00 / 0.00 / - / 2.00 / 0.00 / - / 0.00 / 0.00 / - / 4.25 / 0.43 / 4.0-5.0 / 5.00 / 0.00 / -
21 / Colour of wings and veins / 0.00 / 0.00 / - / 4.75 / 0.56 / 3.50-5.00 / 1.00 / 0.00 / - / 4.00 / 0.00 / - / 2.50 / 0.00 / -
22 / Supraclypeal area weak or strong convex / 0.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / -
23 / Dorsal margin of mandible strongly or not strongly curved / 1.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 1.00 / 0.00 / -
24 / Ratio head size round / 0.93 / 0.00 / - / 0.96 / 0.00 / - / 1.07 / 0.00 / - / 1.07 / 0.00 / - / 1.20 / 0.00 / -
25 / Ratio head size long / 0.93 / 0.00 / - / 1.05 / 0.00 / - / 1.20 / 0.00 / - / 1.20 / 0.00 / - / 1.40 / 0.00 / -
26 / Ratio of punctures in supraclypeal area / 1.20 / 0.00 / - / 0.90 / 0.00 / - / 1.30 / 0.00 / - / 1.10 / 0.00 / - / 1.30 / 0.00 / -
27 / punctures in lower paraocular area / 1.50 / 0.00 / - / 1.40 / 0.00 / - / 0.85 / 0.00 / - / 0.95 / 0.00 / - / 0.90 / 0.00 / 0.90
28 / Metatibial spur pectinate or serrate / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 1.00 / 0.00 / -
29 / Metatibial spur round or spatulate / 0.00 / 0.00 / - / 1.00 / 0.00 / - / 2.00 / 0.00 / - / 0.00 / 0.00 / - / 1.00 / 0.00 / -
30 / number of teeth in the spur / 4.50 / 0.00 / - / 2.50 / 0.50 / 0.50-3.00 / 3.00 / 0.00 / - / 2.00 / 0.00 / - / 3.00 / 0.00 / -
mOTU6 / mOTU7 / mOTU8
Morphological character / mean / SD / range / mean / SD / range / mean / SD / range
1 / Proportion of the superior half divided by the inferior half of the tegula / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.95 / 0.01 / 0.93-0.96
2 / Angle of tegula / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / -
3 / Width of tegula / 299.85 / 0.00 / - / 299.85 / 0.00 / - / 356.22 / 0.00 / -
4 / Length of tegula / 220.01 / 0.00 / - / 220.01 / 0.00 / - / 211.66 / 0.00 / -
5 / Punctation ratio in scutum / 771.93 / 75.42 / 718.60-878.60 / 1249.74 / 0.00 / - / 879.34 / 177.44 / 714.09-1136.00
6 / Mesoscutal punctation density lateral of parapsidal lines (i<d = 1) or i>1.5d= 1.5 or more / 1.00 / 0.00 / - / 1.50 / 0.00 / - / 1.25 / 0.25 / 1.00-1.50
7 / Mesoscutal punctation of parapsidal line ratio (um) / 3.00 / 0.00 / - / 3.00 / 0.00 / - / 3.00 / 0.00 / -
8 / Mesoscutum dull due to tessellate microsculture / 2.00 / 0.00 / - / 2.00 / 0.00 / - / 2.00 / 0.00 / -
9 / Separation of propodeum (mm) / 0.67 / 0.47 / 0.00-1.00 / 0.00 / 0.00 / - / 0.00 / 0.00 / -
10 / Mesepisternum with or without punctation / 1.00 / 0.00 / - / 0.50 / 0.50 / 0.00-1.00 / 1.00 / 0.00 / -
11 / Mesepisternum with punctation / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 2.00 / 0.00 / -
12 / Mesepistermun punctation: reticulate, interspaces imbricate or strong reticulate / 2.00 / 0.00 / - / 2.00 / 0.00 / - / 4.00 / 0.00 / -
13 / Width of parapsidal line (um) / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / -
14 / Percentage of variable sculpture reaching more than halfway to posterior slope of metapostnotum / 0.33 / 0.47 / 0.00-1.00 / 1.00 / 0.00 / - / 1.00 / 0.00 / -
15 / Metapostnotum with posterior margin distinctly convex, projecting beyond dorsolateral / 1.00 / 0.00 / - / 0.50 / 0.50 / 0.00-1.00 / 1.00 / 0.00 / -
16 / Percentage of propodeal triangle with sculpture from base to apex / 0.00 / 0.00 / - / 0.00 / 0.00 / - / 0.00 / 0.00 / -
17 / Form of propodeal triangle / 5.00 / 0.00 / - / 5.00 / 0.00 / - / 1.00 / 0.00 / -
18 / Strong carina present / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.00 / 0.00 / -
19 / Angle of lower gena area produced ventrally into a strong lateral acute angle / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 1.00 / 0.00 / -
20 / Mesepisternum rugulose to tessellate or strongly rugose or not rugose / 2.50 / 0.00 / - / 2.50 / 0.00 / - / 1.00 / 0.00 / -
21 / Colour of wings and veins / 5.00 / 0.00 / - / 5.00 / 0.00 / - / 3.00 / 0.00 / -
22 / Supraclypeal area weak or strong convex / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.00 / 0.00 / -
23 / Dorsal margin of mandible strongly or not strongly curved / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 0.00 / 0.00 / -
24 / Ratio head size round / 1.30 / 0.00 / - / 1.30 / 0.00 / - / 1.32 / 0.00 / -
25 / Ratio head size long / 1.40 / 0.00 / - / 1.40 / 0.00 / - / 1.81 / 0.19 / 1.62-2.00
26 / Ratio of punctures in supraclypeal area / 1.25 / 0.00 / - / 1.25 / 0.00 / - / 0.90 / 0.00 / -
27 / punctures in lower paraocular area / 0.90 / 0.00 / - / 0.90 / 0.00 / - / 0.90 / 0.00 / -
28 / Metatibial spur pectinate or serrate / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 3.00 / 0.00 / -
29 / Metatibial spur round or spatulate / 1.00 / 0.00 / - / 1.00 / 0.00 / - / 3.00 / 0.00 / -
30 / number of teeth in the spur / 3.33 / 0.47 / 3.00-4.00 / 3.00 / 0.00 / - / 3.00 / 0.00 / -

Table S5.Percentages of divergence (P-distance) between mOTUsbasedon mtDNA sequences (belowdiagonal). Numbers in the diagonal (grey background) indicatemaximum intraspecific sequence diversity. Values above thediagonal indicate mean numbers of sites that do not share nucleotides between mOTU pairs.

mOTU1 / mOTU2 / mOTU3 / mOTU4 / mOTU5 / mOTU6 / mOTU7 / mOTU8
mOTU 1 / 0.52 / 18.06 / 33.39 / 35.32 / 26.38 / 33.95 / 38.58 / 54.33
mOTU 2 / 2.78 / 0.83 / 29.76 / 34.54 / 22.63 / 30.22 / 37.40 / 56.91
mOTU 3 / 5.14 / 4.59 / 0.31 / 31.99 / 22.06 / 33.45 / 41.46 / 58.08
mOTU 4 / 5.44 / 5.32 / 4.93 / 0.98 / 25.22 / 31.80 / 38.98 / 58.28
mOTU 5 / 4.06 / 3.49 / 3.40 / 3.89 / 1.18 / 25.62 / 33.92 / 51.51
mOTU 6 / 5.23 / 4.66 / 5.15 / 4.90 / 3.95 / 1.26 / 37.45 / 60.85
mOTU 7 / 5.94 / 5.76 / 6.39 / 6.01 / 5.23 / 5.77 / 2.32 / 51.61
mOTU 8 / 8.37 / 8.77 / 8.95 / 8.98 / 7.94 / 9.38 / 7.95 / 4.23

Table S6. Intergroup genetic diversity obtained with the proportion of the number of different alleles (Fst) between pairs of lineages for microsatellites.

mOTU1 / mOTU2 / mOTU3 / mOTU4 / mOTU5 / mOTU7 / mOTU8
mOTU1
mOTU2 / 0.18
mOTU3 / 0.18 / 0.09
mOTU4 / 0.25 / 0.12 / 0.16
mOTU5 / 0.29 / 0.21 / 0.24 / 0.21
mOTU7 / 0.22 / 0.15 / 0.19 / 0.20 / 0.18
mOTU8 / 0.15 / 0.16 / 0.15 / 0.20 / 0.24 / 0.20

Table S7.Fstand Dest values for microsatellites between sites for mOTU1. Lower left triangle:Fstbetween sites for mOTU1. Upper right triangle: Destbetween sites for mOTU1. Values in bold denote significance; * P<0.05.

mOTU 1
Fst/Dest / Muna / Nenela / SantaMar / TahDziú / Timul / Tixcuytu / Yaxcopil
Muna / 0.00 / 0.03 / 0.02 / 0.03 / 0.05 / 0.01 / 0.06
Nenela / 0.03 / -- / 0.00 / 0.02 / 0.00 / 0.02 / 0.00
SantaMar / 0.02 / 0.01 / 0.00 / 0.01 / 0.00 / 0.00 / 0.00
TahDziú / 0.03 / 0.03 / 0.03 / -- / 0.01 / 0.01 / 0.05
Timul / 0.05* / 0.00 / 0.03 / 0.02* / 0.00 / 0.01 / 0.03
Tixcuytu / 0.03 / 0.02* / 0.01 / 0.01 / 0.02* / -- / 0.02
Yaxcopil / 0.06* / 0.03* / 0.00 / 0.07* / 0.05* / 0.04* / 0.00

Table S8. Fst and Dest values for microsatellites between sites for mOTU6. Lower left triangle:Fstbetween sites for mOTU6. Upper right triangle: Destbetween sites for mOTU6. Values in bold denote significance; * P<0.05.

mOTU 6
Fst/Dest / Timul / Tixmehua / Homun / StaMa / Nenela / TekalVen / RanchoAl / Tixcuytu
Timul / 0.00 / 0.14 / 0.28 / 0.27 / 0.05 / 0.01 / 0.11 / 0.16
Tixmehua / 0.04 / -- / -0.01 / 0.04 / 0.06 / 0.05 / 0.25 / 0.04
Homun / 0.09* / 0.00 / 0.00 / -0.01 / 0.18 / 0.12 / 0.36 / 0.06
StaMa / 0.08 / 0.02 / 0.00 / -- / 0.19 / 0.11 / 0.28 / 0.03
Nenela / 0.02 / 0.02 / 0.07* / 0.06 / 0.00 / 0.03 / 0.16 / 0.02
TekalVen / 0.02 / 0.02 / 0.05 / 0.03 / 0.01 / -- / 0.14 / -0.04
RanchoAl / 0.04 / 0.07 / 0.12 / 0.10 / 0.04 / 0.05* / 0.00 / 0.16
Tixcuytu / 0.05 / 0.01 / 0.02 / 0.01 / 0.01 / -0.01 / 0.05 / 0.00

Table S9.Table ofp-values for the co-occurrence testfor eight mOTUsof Lasioglossum. The eight mOTUswere found in36 combinations;8 pairs (22.00 %) were removed from the analysis because expected co-occurrence was < 1 and 28 pairs were analysed. From these 28 pairs,no significant (P_lt or P_gt <0.05) positive or negative co-occurrences were detected (every p>0.05); abbreviations:Sp1_name and Sp2_name: mOTU names; Sp1_ inc and Sp2_ inc: the number of sites that each mOTU was found at; Obs_co-occurrence: observed number of sites having both species;Prob_co-occurrence: probability that both species occur at a site;Exp_co-occurrence: expected number of sites having both species;P_lt: probability that the two species co-occur at a frequency less than the observed number of co-occurrence sites if the two species were distributed randomly (independent of one another);P_gt: probability of co-occurrence at a frequency greater than that observed.

Sp1_ name / Sp2_ name / Sp1_ inc / Sp2_ inc / Obs_ cooccu / Prob_ cooccu / Exp_ cooccu / P_lt / P_gt
1 / G1 / G2 / 20 / 12 / 12 / 0.54 / 11.40 / 1.00 / 0.43
2 / G1 / G3 / 20 / 18 / 18 / 0.82 / 17.10 / 1.00 / 0.14
3 / G1 / G4 / 20 / 15 / 15 / 0.68 / 14.30 / 1.00 / 0.29
4 / G1 / G5 / 20 / 21 / 20 / 0.95 / 20.00 / 1.00 / 1.00
5 / G1 / G6 / 20 / 19 / 18 / 0.86 / 18.10 / 0.90 / 1.00
6 / G1 / G7 / 20 / 13 / 12 / 0.59 / 12.40 / 0.62 / 1.00
7 / G1 / G8 / 20 / 12 / 11 / 0.54 / 11.40 / 0.57 / 1.00
8 / G2 / G3 / 12 / 18 / 12 / 0.49 / 10.30 / 1.00 / 0.06
9 / G2 / G4 / 12 / 15 / 10 / 0.41 / 8.60 / 0.97 / 0.18
10 / G2 / G5 / 12 / 21 / 12 / 0.57 / 12.00 / 1.00 / 1.00
11 / G2 / G6 / 12 / 19 / 11 / 0.52 / 10.90 / 0.83 / 0.69
12 / G2 / G7 / 12 / 13 / 7 / 0.35 / 7.40 / 0.53 / 0.80
13 / G2 / G8 / 12 / 12 / 6 / 0.33 / 6.90 / 0.38 / 0.89
14 / G3 / G4 / 18 / 15 / 14 / 0.61 / 12.90 / 0.98 / 0.18
15 / G3 / G5 / 18 / 21 / 18 / 0.86 / 18.00 / 1.00 / 1.00
16 / G3 / G6 / 18 / 19 / 16 / 0.78 / 16.30 / 0.73 / 1.00
17 / G3 / G7 / 18 / 13 / 11 / 0.53 / 11.10 / 0.68 / 0.78
18 / G3 / G8 / 18 / 12 / 11 / 0.49 / 10.30 / 0.94 / 0.39
19 / G4 / G5 / 15 / 21 / 15 / 0.71 / 15.00 / 1.00 / 1.00
20 / G4 / G6 / 15 / 19 / 13 / 0.65 / 13.60 / 0.50 / 1.00
21 / G4 / G7 / 15 / 13 / 10 / 0.44 / 9.30 / 0.89 / 0.41
22 / G4 / G8 / 15 / 12 / 10 / 0.41 / 8.60 / 0.97 / 0.18
23 / G5 / G6 / 21 / 19 / 19 / 0.91 / 19.00 / 1.00 / 1.00
24 / G5 / G7 / 21 / 13 / 13 / 0.62 / 13.00 / 1.00 / 1.00
25 / G5 / G8 / 21 / 12 / 12 / 0.57 / 12.00 / 1.00 / 1.00
26 / G6 / G7 / 19 / 13 / 12 / 0.56 / 11.80 / 0.87 / 0.63
27 / G6 / G8 / 19 / 12 / 11 / 0.52 / 10.90 / 0.83 / 0.69
28 / G7 / G8 / 13 / 12 / 8 / 0.35 / 7.40 / 0.83 / 0.47

Table S10. Generalized linear model (GLM) for three environmental variables:Forest, FGP (fallow, garden and pasture) and Crops against the abundance of each mOTU.

Independent variable / Dependent variable / Estimate / error / t / p-value
% Forest / (1) Abundance mOTU1 / -0.74 / 2.07 / -0.36 / 0.73
(2) Abundance mOTU2 / -2.45 / 1.99 / -1.24 / 0.24
(3) Abundance mOTU3 / 6.00 / 7.91 / 0.76 / 0.46
(4) Abundance mOTU4 / -1.86 / 4.63 / -0.40 / 0.70
(5) Abundance mOTU5 / -5.07 / 3.43 / -1.48 / 0.17
(6) Abundance mOTU6 / -1.40 / 1.44 / -0.98 / 0.35
(7) Abundance mOTU7 / 6.94 / 5.17 / 1.34 / 0.21
(8) Abundance mOTU8 / -7.10 / 11.76 / -0.60 / 0.56
(1) Abundance mOTU1 / 0.50 / 1.96 / 0.25 / 0.80
% FGP / (2) Abundance mOTU2 / 0.80 / 1.88 / 0.43 / 0.68
(3) Abundance mOTU3 / 2.82 / 7.49 / 0.38 / 0.71
(4) Abundance mOTU4 / -4.76 / 4.39 / -1.08 / 0.30
(5) Abundance mOTU5 / 1.81 / 3.25 / 0.56 / 0.59
(6) Abundance mOTU6 / 1.89 / 1.36 / 1.39 / 0.19
(7) Abundance mOTU7 / -1.53 / 4.90 / -0.31 / 0.76
(8) Abundance mOTU8 / 8.47 / 11.14 / 0.76 / 0.46
%Crop / (1) Abundance mOTU1 / 0.24 / 0.88 / 0.27 / 0.79
(2) Abundance mOTU2 / 1.65 / 0.85 / 1.95 / 0.08 / .
(3) Abundance mOTU3 / -8.82 / 3.38 / 3.57 / >0.01 / ***
(4) Abundance mOTU4 / 6.62 / 1.98 / 1.59 / 0.13
(5) Abundance mOTU5 / 3.26 / 1.46 / 2.79 / 0.01 / **
(6) Abundance mOTU6 / -0.49 / 0.61 / -0.80 / 0.44
(7) Abundance mOTU7 / -5.41 / 2.21 / -0.72 / 0.48
(8) Abundance mOTU8 / -1.37 / 5.02 / -0.27 / 0.79

Figure S1.Characters used for morphologic analyses of mOTUs;S1A. Lateral view of a Lasioglossum specimen showing the morphological traits used in this study (character 1-27). S1B. Hind leg, showing the morphological traits used (characters 28-30) (modified from Andrus 2007).

Figure S2.Delta K graphs for each of the lineages showing the most likely K chosen by STRUCTURE software (Pritchard et al. 2000).The values of the best K for each lineage tested were:mOTU1 best K=2(delta K2= 8.58);and mOTU7, best K=3 (delta K3= 3.60).

Figure S3.Bubble plot of the only land use type (Crop, as % of total land use) that showed a significant relationship with the diversity of speciesmeasured as mOTU abundance. The size of the circles indicates the abundance of each taxon related with different percentage of land usewith crops. The distribution of mOTUs 3 and 5 had a significant positive relationship with crop area.

Andrus Nelson, R. (2007). Bee lateral view. Discover life.

Ascher, J. S., & Pickering, J. (2015). Discover Life bee species guide and world checklist (Hymenoptera: Apoidea: Anthophila).
November 2015.

Pritchard, J. K., Stephens, M., & Donnelly, P. (2000). Inference of Population Structure Using Multilocus Genotype Data. Genetics, 155(2), 945–959.

1