Supplemental Experimental Procedures
Genotyping
Genomic DNA was isolated from portions of mouse livers (100 mg) by phenol extraction. The aqueous phase obtained after phenol extraction was re-extracted twice with chloroform (1:1, v/v). Nucleic acids were precipitated with 0.1 volume 3 M sodium acetate plus 2.5 volumes ethanol at -20oC overnight, collected by centrifugation (13200 g, 30 min, 4oC), air-dried, dissolved in 50 µL deionized water, and quantified at 260 nm using NanoDrop.
DNA was genotyped by PCR using the Blmh intron 2 forward primer p1 (CACTGTAGCTGTACTCACAC), Blmh exon 3 reverse primer p2 (GCGACAGAGTACCATGTAGG) and neomycin cassette reverse primer p3 (ATTTGTCACGTCCTGCACGACG) as described by Schwartz et al. (Schwartz, Homanics et al. 1999). Briefly, the 10 μL PCR mixture contained 100 ng purified mouse DNA, 5µl PCR MasterMix (Fermentas), 0.5 μL primer p1, p2, p3, 0.5 units of Taq polymerase (Fermentas) and water to 10 μL. The thermal cycling reaction was run for 34 cycles of 92°C for 30 s, 65°C for 40 s and 72°C for 90 s. The 0.7 kb amplicon from the Blmh wild-type allele (obtained with p1, p2 primers) and the 0.95 kb amplicon from the Blmh-null allele (obtained with p1, p3 primers) were distinguished on a 1.5% agarose gel stained with SYBRSafe (Invitrogen).
Proteomic analyses
Sample preparation
Liver proteins were extracted using the phenol extraction method that allows efficient protein recovery and removes non-protein components (Faurobert, Pelpoir et al. 2007). The liver was disintegrated by grinding with dry ice using a mortar and a pestle. A 100 mg portion of the pulverized liver material was extracted with 0.9 mL of extraction buffer (0.5 M Tris-HCl pH 7.5, 50mM EDTA, 0.1 M KCl, 0.7 M sucrose, 2% w/v DTT) containing protease inhibitors (Protease Inhibitor Mix, GE Healthcare) and 1 mL phenol containing 0.1 % hydroxyquinoline with vigorous shaking (10 min, 4°C). (The remaining portion of the ground liver was saved and stored at -80°C.) The mixture was centrifuged (12 000 g, 10 min, 4°C), the phenol layer collected, and extracted again with an equal volume of the extraction buffer. The phenol layer was separated by centrifugation, collected, and the proteins precipitated with 5 volumes of 0.1 M ammonium acetate in methanol (-80°C, 2 days). The protein pellet was collected by centrifugation (12 000 x g, 10 min, 4°C), washed 3 times with 0.1 M ammonium acetate in methanol, followed by 5-min washes with 80% and 100% acetone, and allowed to dry in the air.
Liver protein samples were dissolved in IEF rehydration buffer (7 M urea, 2 M thiourea, 2% CHAPS, 55 mM DTT, 0.5% v/v ampholite pH 4-7, GE Healthcare). Insoluble material was removed by centrifugation (16 000 g, 20 min). Protein concentration was determined using a commercial 2-D Quant kit (GE Healthcare).
Two-dimensional IEF/SDS-PAGE
Protein separations and image analysis were carried out as described in ref. (Luczak, Formanowicz et al. 2011). IPG strips (11 cm, pH 4-7, GE Healthcare) were rehydrated overnight in IEF buffer containing liver protein samples, 0.3 mg/strip. The strips were subjected to IEF on IPGphor III apparatus (GE Healthcare) using a ramping voltage (50 - 6000 V) to final 25 000 Vh. After IEF, IPG strips were incubated for 15 min in an equilibration buffer (6 M urea, 2% w/v SDS, 30% v/v glycerol, 50 mM Tris/HCl pH 8.8) containing 1% w/v DTT during the first equilibration step and 2.5% iodoacetamide w/v during the second equilibration step. The second dimension was carried out using 11% polyacrylamide gels (24 x 24 cm) on an Ettan DALT six system (GE Healthcare) according to the manufacturer's instructions. For each sample, a 2D analysis was repeated three times. After electrophoresis, gels were stained with Blue Silver overnight (Candiano, Bruschi et al. 2004) and scanned using an Umax scanner and LabScan software (GE Healthcare).
The images were analyzed using the Image Master Platinum software version 7.0 (GE Healthcare). Spots were detected automatically without filtering. Gel patterns were automatically matched between groups. In addition, all individual matched spots were validated manually to ensure the correctness of spot matching. For each identified protein, the relative abundance (% volume) was calculated from its area and intensity divided by the total volume of all protein spots on a gel (Luczak, Kazmierczak et al. 2012). This procedure corrects for small variations between individual gels due to protein loading and staining.
Reproducibility of the IEF/SDS-PAGE analyses
For each studied animal in each experimental group IEF/SDS-PAGE analyses and % volume measurements for the differentially expressed proteins were repeated 2-4 times. The variations in 5 volume were from 4.5±1.5% (for Ddah1) to for 8.6±2.7% (for Gamt).
Mass spectrometry
Protein spots were manually excised from gels using Pasteur pipets, transferred to Eppendorf tubes, de-stained by series of washes with 50 mM ammonium bicarbonate, 25 mM ammonium bicarbonate + 50% acetonitrile, and dehydrated with neat acetonitrile according to a procedure described in ref. (Shevchenko and Shevchenko 2001). The dried gel pieces were digested with 10µl 20 ng/µl trypsin (Promega), 25 mM ammonium bicarbonate (37oC, 16 h). Tryptic peptides were recovered from gel pieces by adding acetonitrile (to 10%), sonication in an ultrasound bath for 5 min, followed by 0.5 h incubation at 4°C.
The proteins were identified using an Autoflex MALDI-TOF (Bruker Daltonics, Germany) mass spectrometer operated in reflector mode and using delayed ion extraction as described in ref. (Luczak, Formanowicz et al. 2011). Positively charged ions in the m/z range 820-3500 were analyzed. 0.5 μl of the sample was co-crystallized with a CHCA matrix and spotted directly on MALDI AnchorChip 600 nm target (Bruker Daltonics). For data validation, external calibration was performed with a standard mixture of peptides with masses from 700 to 3500 Da (Peptide Calibration Standards 1 – Bruker). Flex control v 2.0 was used for the acquisition of spectra and all further data processing was carried out using Flex analysis v 2.0. Monoisotopic peptide masses were assigned and used for databases search. The proteins were identified by peptide mass fingerprinting using the Mascot (Matrix Science, London, UK) program against UniProtKB/Swiss-Prot database. The protein search was done using the following search parameters: mass tolerance +/-0.2 Da, one allowed missed cleavage, cysteine treated with iodoacetamide to form carbamidomethyl-cysteine and methionine in the oxidized form.
Western blotting
Liver protein extracts for Western blotting were prepared using a FastPrep24 apparatus (MP Biomedicals). Portions of livers (200 mg) were homogenized at 4°C with 400 µL 0.1 M K-HEPES buffer, pH 7.4, 2mM CaCl2, 1mM DTT, and protease inhibitor cocktail in Lysing Matrics M tubes (shaker speed 6 m/s, 40 s). The extract was clarified by centrifugation (14 000 g, 4°C, 15 min), the supernatant collected, and protein concentration quantified using the Bradford assay (Bio-Rad).
Extracts containing identical amount of protein (10 μg) were added to the sample buffer (125 mM Tris-HCl pH 6.8, 4% SDS, 20% glycerol, 10% 2-mercaptoethanol), denatured (100°C, 5 min), and subjected to SDS-PAGE on gels (10 x 10 cm, 12 %, Bis-Tris NuPAGE, Invitrogen). The separated proteins were transferred to a PVDF membrane using ECL Semi-dry Blotter TE 77 (GE Healthcare) (60V, 1 h). The PVDF membrane was blocked with 4% BSA in PBS, 0.1% Tween-20 and the blots were incubated overnight with anti-ApoA1, anti-ferritin light chain, or anti-actin primary antibody (all from Santa Cruz Biotechnology). Anti-mouse IgG conjugated to horseradish peroxidase (Sigma) was used as a secondary antibody. After washing away the excess of the secondary antibody, the membrane was incubated with ChemiFast Chemiluminescence Substrate (2 min in the dark; Syngene) and the resulting chemiluminescent bands recorded using Gbox-Chemi apparatus (Syngen).
Glod4 mRNA analysis
Total RNA was isolated from approximately 30 mg C57BL/6J Blmh–/–or Blmh+/+ mouse liver tissue using Total RNA Purification Kit (Novazym) following the manufacture’s protocol. RNA was transcribed by oligo(dT)23, Anchored (Sigma) to cDNA according to the manufacturer’s instructions (Enhanced Avian Reverse Transcriptase, Sigma) and a reverse transcription reaction (20 µL) was carried at 45oC for 50 min. A 2 µL aliquot from the RT reaction was used for PCR amplification (in 50 µL reaction mixture) with AccuTaqTM LA DNA polymerase (Sigma) and one of pairs of primers complementary to each of three mouse Glod4 mRNA isoforms (Suppl. Table 1) (http://www.uniprot.org/uniprot/Q9CPV4). The PCR parameters were as follows: 94oC, 2.5 min; 10 cycles of (94oC for 30 s; 53oC for 30 s and 68oC for 60 s) and 20 cycles of (94oC for 30 s, 66oC for 30 s and 68oC for 60 s). Products of the RT–PCR were analyzed by agarose gel electrophoresis. Experiment was repeated three times using different individual Blmh–/– mouse liver tissue.
Suppl. Table1. Sequences of primers used in Glod4 mRNA amplification.
Glod4 isoform / Primer name / Primer sequence (5’"3’)1, 2 / Glod4-1_fw / ggggtaccatcgaaggtcgtATGGCCACTCGTCGAGCT
1, 3 / Glod4-1_rev / aactgcagCTAACCCGAAGCCTTTGGTT
2 / Glod4-2_rev / aactgcagTCAGCCAGGATTTGCTGTC
3 / Glod4-3_fw / ggggtaccatcgaaggtcgtATGATCTGTGGCTCTGTTCT
Supplementary references
Candiano, G., M. Bruschi, L. Musante, L. Santucci, G. M. Ghiggeri, B. Carnemolla, P. Orecchia, L. Zardi and P. G. Righetti (2004). "Blue silver: a very sensitive colloidal Coomassie G-250 staining for proteome analysis." Electrophoresis 25(9): 1327-1333.
Faurobert, M., E. Pelpoir and J. Chaib (2007). "Phenol extraction of proteins for proteomic studies of recalcitrant plant tissues." Methods Mol Biol 355: 9-14.
Luczak, M., D. Formanowicz, E. Pawliczak, M. Wanic-Kossowska, A. Wykretowicz and M. Figlerowicz (2011). "Chronic kidney disease-related atherosclerosis - proteomic studies of blood plasma." Proteome Sci 9: 25.
Luczak, M., M. Kazmierczak, L. Handschuh, K. Lewandowski, M. Komarnicki and M. Figlerowicz (2012). "Comparative proteome analysis of acute myeloid leukemia with and without maturation." J Proteomics 75(18): 5734-5748.
Schwartz, D. R., G. E. Homanics, D. G. Hoyt, E. Klein, J. Abernethy and J. S. Lazo (1999). "The neutral cysteine protease bleomycin hydrolase is essential for epidermal integrity and bleomycin resistance." Proc Natl Acad Sci U S A 96(8): 4680-4685.
Shevchenko, A. and A. Shevchenko (2001). "Evaluation of the efficiency of in-gel digestion of proteins by peptide isotopic labeling and MALDI mass spectrometry." Anal Biochem 296(2): 279-283.