Supporting Information
Table S1 Overview of the six candidate genes included in the study. N markers – number of genetic markers that were used in this study per gene. The markers were located both in upstream region and within each gene (CDS and introns).
Gene code / Gene full name(abbr. name, NCBI symbol) / GeneID / Chromosome (strand) / Chromosomal position / Exons total length [bp] / Introns total length [bp] / %CDS se-quen-ced / N mar-kers
DE / Dopamine /ecdysone receptor
(Amgpcr19, DopEcR) / 413040 / LG6
(-) / NC_007075.3 (3095518..
3100063 ) / 942 / 3603 / 45.6 / 16
O2 / Octopamine receptor 2
(AmoctβR1, Amoa2,
Oa2) / 413698 / LG7
(-) / NC_007076.3 (235096..
287460) / 1287 / 51573 / 5.4 / 14
D3 / D2-like dopamine receptor
(Amdop3,
Dop3) / 408995 / LG9
(-) / NC_007078.3 (8842717..
8981713) / 3250 / 135749 / 4.8 / 16
O1 / Octopamine receptor 1
(AmoctαR1, Amoa1,
Oa1) / 406068 / LG15
(-) / NC_007084.3 (3160527..
3176658) / 3000 / 23560 / 12.2 / 6
D2 / Dopamine receptor D2
(Amdop2,
DopR2) / 406070 / LG15
(+) / NC_007084.3 (6784429..
6844358) / 4031 / 55900 / 41.3 / 8
D1 / Dopamine receptor D1
(Amdop1,
Dop1) / 406111 / LG15
(+) / NC_007084.3 (7792402..
7842026) / 2817 / 3286 / 43.6 / 18
Table S2 PCR and sequencing primers used in this study. For the explanation of gene codes see Table 1. Abbreviations for receptor-coding genes: D1 – Amdop1, D2 – Amdop2, D3 – Amdop3, DE – AmDopEcR (Amgpcr19), O1 – Amoa1 (AmoctαR1), O2 – Amoa2 (AmoctβR1).
Gene code / Primer pair (set code) / Primer name / Primer sequence / Exp. PCR product size [bp]DE / S19 / DEp37F / GTTTTGATTCCGCGATGTTT / 802
DEp38R / ACACCGACCACGAAGATGA
S25 / DEg49F / TCAATCCTGGAAATTGAATGAA / 801
DEg50R / TGCAAATTTTATGAGCATCCA
O2 / S62 / O2p123F / GGACAAACTTCGCCTCAAAC / 607
O2p124R / TGTCGACGAAAATGTTGGAA
S65 / O2g129F / TGTTTGTGTTCCTTCCGAGA / 607
O2g130R / AAGTCCCGGTTGAAGTAGGC
D3 / S41 / D3p81F / GGTGTGGGACACGAAAGAGT / 587
D3p82R / GCCACGAGATTGCACAAATA
S47 / D3g93F / GGTACGTCACGCGAAAAGAT / 601
D3g94R / AGGGAGTGTTTGCGTAGTGG
O1 / S12 / O1p23F / CTCGTGAAGGGATGGATGTT / 949
O1p24R / TTTGTGCGTCTCTCTTGCAT
S11 / O1g21F / CAATGTCTCGCCAAAGTTGA / 857
O1g22R / GTGGGAAGCAGATGACGAAG
D2 / S06 / D2p11F / ACCGAATCTGACACACGACA / 645
D2p12F / CCTTGCACAGAGAGAAAACG
S04 / D2g07F / CAGGAGGAGGATCTGTGGAA / 848
D2g08R / GCCCCTAGTGTGCTGTTTGT
D1 / S03 / D1p05F / TTGCATAAATACAGGCTTTACGTC / 602
D1p06R / ACCGACAACAGCGAGAAAGT
S01 / D1g01F / TCCGTTTTTCGTATGTCGTG / 576
D1g02R / GTCACCCAACGACCGTATCT
Table S3 Summary of the genetic markers data. Shown are marker name, chromosome, contig position, gene code (as in Table 1) and position relatively to the gene (promotor region, exon/intron). For SNPs located in exons text in brackets tells whether it is synonimous or nonsynonimous substitution. A hash (#) next to a marker name indicates markers that failed quality check (too low minor allele frequency) and were not used for GWAS with GENABEL. A1 and A2 stand for the first and second alleles. P.11, P.12 and P.22 represent number of individuals with a given genotype. Q.2 is the frequency of the second allele (A2) and Pexact is a p-value of the exact test for Hardy Weinberg Equilibrium (HWE). Genomic positions of SNPs were confirmed by blasting relevant fragments of sequences from experimental bees on the Apis mellifera whole genome shotgun sequence genomic scaffold (Amel_4.5). For analyses, indels were coded as A/T SNPs, with A standing for an (longer) allele without a gap and T for an (shorter) allele with a gap. Abbreviations for receptor-coding genes: D1 – Amdop1, D2 – Amdop2, D3 – Amdop3, DE – AmDopEcR (Amgpcr19), O1 – Amoa1 (AmoctαR1), O2 – Amoa2 (AmoctβR1).
Marker name / Chr / Contig / position / Gene code / Prom./exon/
intron / A1 / A2 / Q.2 / P.11 / P.12 / P.22 / Pexact
SNP_DE_S25_2997 / 6 / NC_007075.3 / 3097610 / DE / i / C / G / 0.43 / 38 / 40 / 23 / 0.07
SNP_DE_S25_2928# / 6 / NC_007075.3 / 3097679 / DE / i / C / T / 0.01 / 99 / 2 / 0 / 1.00
SNP_DE_S25_2866 / 6 / NC_007075.3 / 3097741 / DE / i / T / C / 0.42 / 38 / 41 / 22 / 0.10
SNP_DE_S25_2856 / 6 / NC_007075.3 / 3097751 / DE / i / C / T / 0.43 / 38 / 40 / 23 / 0.07
SNP_DE_S25_2841 / 6 / NC_007075.3 / 3097766 / DE / i / A / G / 0.43 / 38 / 40 / 23 / 0.07
SNP_DE_S25_2769 / 6 / NC_007075.3 / 3097838 / DE / i / G / A / 0.38 / 44 / 37 / 20 / 0.03
SNP_DE_S25_2715 / 6 / NC_007075.3 / 3097892 / DE / i / G / A / 0.38 / 44 / 37 / 20 / 0.03
SNP_DE_S25_2469 / 6 / NC_007075.3 / 3098138 / DE / e (syn.) / T / C / 0.38 / 44 / 37 / 20 / 0.03
SNP_DE_S25_2442 / 6 / NC_007075.3 / 3098165 / DE / e (syn.) / C / T / 0.38 / 44 / 37 / 20 / 0.03
SNP_DE_S25_2337 / 6 / NC_007075.3 / 3098270 / DE / i / C / T / 0.40 / 40 / 41 / 20 / 0.15
SNP_DE_S25_2310 / 6 / NC_007075.3 / 3098297 / DE / i / A / G / 0.40 / 40 / 41 / 20 / 0.15
SNP_DE_S19_632 / 6 / NC_007075.3 / 3099975 / DE / p / G / A / 0.47 / 28 / 52 / 21 / 0.84
SNP_DE_S19_549 / 6 / NC_007075.3 / 3100060 / DE / p / C / T / 0.40 / 40 / 41 / 20 / 0.15
SNP_DE_S19_533 / 6 / NC_007075.3 / 3100076 / DE / p / A / G / 0.40 / 40 / 41 / 20 / 0.15
SNP_DE_S19_301 / 6 / NC_007075.3 / 3100307 / DE / p / T / A / 0.40 / 40 / 41 / 20 / 0.15
ind_DE_S19_283 / 6 / NC_007075.3 / 3100336 / DE / p / A / T / 0.40 / 40 / 41 / 20 / 0.15
ind_O2_S65_53050 / 7 / NC_007076.3 / 235503 / O2 / i / A / G / 0.39 / 43 / 38 / 20 / 0.04
SNP_O2_S65_52960 / 7 / NC_007076.3 / 235593 / O2 / i / C / T / 0.37 / 43 / 41 / 17 / 0.20
SNP_O2_S65_52944 / 7 / NC_007076.3 / 235609 / O2 / i / C / T / 0.37 / 43 / 41 / 17 / 0.20
SNP_O2_S65_52914 / 7 / NC_007076.3 / 235639 / O2 / i / T / A / 0.37 / 43 / 41 / 17 / 0.20
SNP_O2_S65_52912 / 7 / NC_007076.3 / 235641 / O2 / i / A / G / 0.37 / 43 / 41 / 17 / 0.20
SNP_O2_S65_52902 / 7 / NC_007076.3 / 235651 / O2 / i / G / A / 0.37 / 43 / 41 / 17 / 0.20
SNP_O2_S65_52901 / 7 / NC_007076.3 / 235652 / O2 / i / T / C / 0.37 / 43 / 41 / 17 / 0.20
SNP_O2_S65_52899 / 7 / NC_007076.3 / 235654 / O2 / i / T / C / 0.37 / 43 / 41 / 17 / 0.20
SNP_O2_S65_52861# / 7 / NC_007076.3 / 235687 / O2 / i / G / A / 0.07 / 87 / 14 / 0 / 1.00
SNP_O2_S65_52837 / 7 / NC_007076.3 / 235711 / O2 / i / G / A / 0.47 / 27 / 53 / 21 / 0.69
SNP_O2_S65_52772 / 7 / NC_007076.3 / 235775 / O2 / i / C / T / 0.47 / 27 / 53 / 21 / 0.69
SNP_O2_S65_52770 / 7 / NC_007076.3 / 235777 / O2 / i / C / T / 0.47 / 27 / 53 / 21 / 0.69
ind_O2_S62_203 / 7 / NC_007076.3 / 287842 / O2 / p / A / T / 0.09 / 83 / 18 / 0 / 1.00
SNP_O2_S62_196 / 7 / NC_007076.3 / 287849 / O2 / i / C / T / 0.17 / 67 / 34 / 0 / 0.07
ind_D3_S47_129131 / 9 / NC_007078.3 / 8851849 / D3 / i / A / T / 0.40 / 38 / 46 / 17 / 0.68
SNP_D3_S47_129119 / 9 / NC_007078.3 / 8851861 / D3 / i / A / G / 0.49 / 28 / 48 / 25 / 0.69
SNP_D3_S47_129118 / 9 / NC_007078.3 / 8851862 / D3 / i / G / A / 0.40 / 38 / 46 / 17 / 0.68
SNP_D3_S47_129110 / 9 / NC_007078.3 / 8851870 / D3 / i / G / A / 0.40 / 38 / 46 / 17 / 0.68
SNP_D3_S47_129015 / 9 / NC_007078.3 / 8851965 / D3 / e (syn.) / C / T / 0.34 / 40 / 53 / 8 / 0.12
SNP_D3_S41_380 / 9 / NC_007078.3 / 8980602 / D3 / p / T / C / 0.27 / 55 / 37 / 9 / 0.45
SNP_D3_S41_372 / 9 / NC_007078.3 / 8980610 / D3 / p / A / C / 0.41 / 39 / 42 / 20 / 0.21
SNP_D3_S41_357 / 9 / NC_007078.3 / 8980625 / D3 / p / C / T / 0.32 / 50 / 37 / 14 / 0.11
SNP_D3_S41_351 / 9 / NC_007078.3 / 8980631 / D3 / p / A / C / 0.09 / 83 / 18 / 0 / 1.00
SNP_D3_S41_268 / 9 / NC_007078.3 / 8980714 / D3 / p / C / T / 0.32 / 50 / 37 / 14 / 0.11
SNP_D3_S41_236 / 9 / NC_007078.3 / 8980746 / D3 / p / A / G / 0.32 / 50 / 37 / 14 / 0.11
SNP_D3_S41_203 / 9 / NC_007078.3 / 8980779 / D3 / p / G / A / 0.41 / 37 / 45 / 19 / 0.42
SNP_D3_S41_184 / 9 / NC_007078.3 / 8980798 / D3 / p / A / G / 0.41 / 37 / 45 / 19 / 0.42
SNP_D3_S41_177 / 9 / NC_007078.3 / 8980805 / D3 / p / T / A / 0.41 / 37 / 45 / 19 / 0.42
SNP_D3_S41_163 / 9 / NC_007078.3 / 8980819 / D3 / p / C / T / 0.41 / 37 / 45 / 19 / 0.42
SNP_D3_S41_159 / 9 / NC_007078.3 / 8980823 / D3 / p / T / C / 0.41 / 37 / 45 / 19 / 0.42
ind_O1_S11_8815 / 15 / NC_007084.3 / 3169554 / O1 / i / T / A / 0.35 / 41 / 50 / 10 / 0.51
SNP_O1_S12_648 / 15 / NC_007084.3 / 3177775 / O1 / p / T / C / 0.26 / 55 / 39 / 7 / 1.00
SNP_O1_S12_610 / 15 / NC_007084.3 / 3177813 / O1 / p / T / C / 0.35 / 40 / 52 / 9 / 0.27
SNP_O1_S12_609 / 15 / NC_007084.3 / 3177814 / O1 / p / C / T / 0.35 / 40 / 52 / 9 / 0.27
SNP_O1_S12_574 / 15 / NC_007084.3 / 3177849 / O1 / p / C / T / 0.35 / 40 / 52 / 9 / 0.27
SNP_O1_S12_546 / 15 / NC_007084.3 / 3177877 / O1 / p / C / T / 0.11 / 83 / 14 / 4 / 0.01
ind_D2_S06_133# / 15 / NC_007084.3 / 6783957 / D2 / p / A / T / 0.01 / 99 / 2 / 0 / 1.00
SNP_D2_S06_162 / 15 / NC_007084.3 / 6783984 / D2 / p / T / C / 0.06 / 89 / 12 / 0 / 1.00
SNP_D2_S06_190 / 15 / NC_007084.3 / 6784012 / D2 / p / C / T / 0.43 / 36 / 44 / 21 / 0.31
SNP_D2_S06_202 / 15 / NC_007084.3 / 6784024 / D2 / p / T / C / 0.48 / 30 / 46 / 25 / 0.43
SNP_D2_S04_21819 / 15 / NC_007084.3 / 6805743 / D2 / e (syn.) / G / C / 0.37 / 39 / 49 / 13 / 0.83
SNP_D2_S04_21859 / 15 / NC_007084.3 / 6805783 / D2 / e (Lys/Glu) / A / G / 0.37 / 47 / 34 / 20 / 0.01
SNP_D2_S04_21891 / 15 / NC_007084.3 / 6805815 / D2 / e (syn.) / G / A / 0.26 / 52 / 45 / 4 / 0.20
SNP_D2_S04_22025 / 15 / NC_007084.3 / 6805933 / D2 / e (syn.) / C / T / 0.32 / 49 / 39 / 13 / 0.26
SNP_D1_S03_190 / 15 / NC_007084.3 / 7835512 / D1 / p / G / A / 0.1 / 80 / 21 / 0 / 0.59
SNP_D1_S03_204 / 15 / NC_007084.3 / 7835526 / D1 / p / G / A / 0.28 / 52 / 42 / 7 / 0.81
SNP_D1_S03_349 / 15 / NC_007084.3 / 7835671 / D1 / p / G / A / 0.28 / 52 / 42 / 7 / 0.81
SNP_D1_S03_389 / 15 / NC_007084.3 / 7835711 / D1 / p / T / C / 0.28 / 52 / 42 / 7 / 0.81
SNP_D1_S03_412 / 15 / NC_007084.3 / 7835734 / D1 / p / G / C / 0.25 / 57 / 37 / 7 / 0.79
SNP_D1_S03_417 / 15 / NC_007084.3 / 7835739 / D1 / p / C / G / 0.25 / 57 / 37 / 7 / 0.79
SNP_D1_S03_427 / 15 / NC_007084.3 / 7835749 / D1 / p / A / G / 0.25 / 57 / 37 / 7 / 0.79
SNP_D1_S03_433 / 15 / NC_007084.3 / 7835755 / D1 / p / A / G / 0.25 / 57 / 37 / 7 / 0.79
SNP_D1_S03_493 / 15 / NC_007084.3 / 7835815 / D1 / p / G / A / 0.17 / 71 / 26 / 4 / 0.47
SNP_D1_S03_537 / 15 / NC_007084.3 / 7835859 / D1 / p / A / G / 0.25 / 57 / 37 / 7 / 0.79
SNP_D1_S03_641 / 15 / NC_007084.3 / 7835963 / D1 / e (Asp/Asn) / A / G / 0.26 / 56 / 38 / 7 / 0.80
SNP_D1_S01_1209 / 15 / NC_007084.3 / 7836555 / D1 / i / C / G / 0.09 / 86 / 11 / 4 / 0.00
SNP_D1_S01_1494 / 15 / NC_007084.3 / 7836840 / D1 / i / C / T / 0.20 / 69 / 24 / 8 / 0.02
SNP_D1_S01_1498 / 15 / NC_007084.3 / 7836844 / D1 / i / G / A / 0.20 / 69 / 24 / 8 / 0.02
SNP_D1_S01_1501 / 15 / NC_007084.3 / 7836847 / D1 / i / A / G / 0.07 / 87 / 14 / 0 / 1.00
SNP_D1_S01_1502 / 15 / NC_007084.3 / 7836848 / D1 / i / G / A / 0.20 / 69 / 24 / 8 / 0.02
SNP_D1_S01_1512 / 15 / NC_007084.3 / 7836858 / D1 / i / C / T / 0.20 / 69 / 24 / 8 / 0.02
ind_D1_S01_1533 / 15 / NC_007084.3 / 7836879 / D1 / i / T / A / 0.20 / 69 / 24 / 8 / 0.02
Table S4 Summary of the levels of genetic variation in gene elements. Genetic variation was calculated as Watterson's estimator (θw) of the population mutation rate (θ) per base using the number of SNPs segregating in exonic, intronic and promoter sequences of each of the studied genes.
Gene code / exonic / intronic / promotorD1 / 0.0005 / 0.006 / 0.004
D2 / 0.001 / - / 0.007
D3 / 0.002 / 0.008 / 0.009
DE / 0.001 / 0.003 / 0.002
O1 / 0.000 / 0.001 / 0.002
O2 / 0.000 / 0.015 / 0.002
Average / 0.0008 / 0.0066 / 0.0044
Table S5 Top allelic association hits in the single-marker association tests for six phenotypic traits related to appetitive and aversive learning in honeybees. * – non-synonymous SNP. For the explanation of gene codes see Table 1. Phenotypic traits: Appe_LS – appetitive learning score, Aver_LSt – aversive learning score (transformed), Appe_MS – appetitive memory score, Aver_MS – aversive memory score. Abbreviations for receptor-coding genes: D1 – Amdop1, D2 – Amdop2, D3 – Amdop3, DE – AmDopEcR (Amgpcr19), O1 – Amoa1 (AmoctαR1), O2 – Amoa2 (AmoctβR1). For analyses, indels were coded as A/T SNPs, with A standing for an (longer) allele without a gap and T for an (shorter) allele with a gap. Statistically significant (< 0.05) p-values are displayed in bold.
Trait / Genetic markers / Gene code / Chr / Chromosomal position / Alleles / Assoc. p-value / Prop. var. expl. by markerAppe_LS
SNP_D1S03_190 / D1 / 15 / 1825013 / G/A / 0.044 / 0.086
SNP_D1S01_1494 / D1 / 15 / 1820091 / C/T / 0.044 / 0.086
SNP_D1S01_1498 / D1 / 15 / 1820095 / G/A / 0.044 / 0.086
SNP_D1S01_1502 / D1 / 15 / 1820099 / G/A / 0.044 / 0.086
SNP_D1S01_1512 / D1 / 15 / 1820109 / C/T / 0.044 / 0.086
ind_D1S01_1533 / D1 / 15 / 1820130 / T/A / 0.044 / 0.086
SNP_D1S03_412 / D1 / 15 / 1825235 / G/C / 0.055 / 0.077
SNP_D1S03_417 / D1 / 15 / 1825240 / C/G / 0.055 / 0.077
SNP_D1S03_427 / D1 / 15 / 1825250 / A/G / 0.055 / 0.077
SNP_D1S03_433 / D1 / 15 / 1825256 / A/G / 0.055 / 0.077
SNP_D1S03_537 / D1 / 15 / 1825360 / A/G / 0.055 / 0.077
Aver_LS
SNP_O1S12_546 / O1 / 15 / 273854 / C/T / 0.052 / 0.040
SNP_DES25_2337 / DE / 6 / 282701 / C/T / 0.082 / 0.031
SNP_DES25_2310 / DE / 6 / 282728 / A/G / 0.082 / 0.031
SNP_DES19_549 / DE / 6 / 284483 / C/T / 0.082 / 0.031
SNP_DES19_533 / DE / 6 / 284497 / A/G / 0.082 / 0.031
SNP_DES19_301 / DE / 6 / 284728 / T/A / 0.082 / 0.031
SNP_DES19_283 / DE / 6 / 284757 / A/T / 0.082 / 0.031
Appe_MS
SNP_D1S03_204 / D1 / 15 / 1825027 / G/A / 0.025 / 0.054
SNP_D1S03_349 / D1 / 15 / 1825172 / G/A / 0.025 / 0.054
SNP_D1S03_389 / D1 / 15 / 1825212 / T/C / 0.025 / 0.054
SNP_D1S03_190 / D1 / 15 / 1825013 / G/A / 0.031 / 0.049
SNP_DES25_2337 / DE / 6 / 282701 / C/T / 0.084 / 0.031
SNP_DES25_2310 / DE / 6 / 282728 / A/G / 0.084 / 0.031
SNP_DES19_549 / DE / 6 / 284483 / C/T / 0.084 / 0.031
SNP_DES19_533 / DE / 6 / 284497 / A/G / 0.084 / 0.031
SNP_DES19_301 / DE / 6 / 284728 / T/A / 0.084 / 0.031
SNP_DES19_283 / DE / 6 / 284757 / A/T / 0.084 / 0.031
Aver_MS
SNP_D1S03_641 / D1 / 15 / 1825463 / A/G / 0.033 / 0.048
SNP_D1S03_412 / D1 / 15 / 1825235 / G/C / 0.048 / 0.041
SNP_D1S03_417 / D1 / 15 / 1825240 / C/G / 0.048 / 0.041
SNP_D1S03_427 / D1 / 15 / 1825250 / A/G / 0.048 / 0.041
SNP_D1S03_433 / D1 / 15 / 1825256 / A/G / 0.048 / 0.041
SNP_D1S03_537 / D1 / 15 / 1825360 / A/G / 0.048 / 0.041
SNP_D1S03_493 / D1 / 15 / 1825316 / G/A / 0.054 / 0.039
Table S6 MultiPhen analysis results summary. Phenotypic traits related to appetitive-learning and to aversive learning, respectively, were modeled jointly as predictors of the genotypes to test for multi-phenotype associations. Abbreviations for receptor-coding genes: D1 – Amdop1, D2 – Amdop2, D3 – Amdop3, DE – AmDopEcR (Amgpcr19), O1 – Amoa1 (AmoctαR1), O2 – Amoa2 (AmoctβR1). Statistically significant (< 0.05) p-values are displayed in bold. Other labels are as in SupplTable2.