Supplemental materials and methods
Blood agar plate (BAP) culture
100 mg fresh stool was dissolved by 1ml PBS, and then serially diluted. Dilutions (10-6, 10-7, 10-8) of 100 μl volume were coated on the blood agar plates (9cm, Hefei Tianda Diagnostic Reagent, Co., Ltd.). After 36 h culture in air incubator at 37°C, CFU of bacteria were measured.
Real-time PCR procedure
Gene-specific primers are as followed: TGF-β (F: attcagcgctcactgctctt; r: tctctgtggagctgaagcaa; 218bp), IL-1β (F: gaccttccaggatgaggaca; R: aggccacaggtattttgtcg; 284bp) (1), IL-6 (F: aacgatgatgcacttgcaga ; R: ggaaattggggtaggaagga; 276bp) (2)), IL-23(F: ccagcgggacatatgaatct ; R: aggctcccctttgaagatgt; 195bp) (3), β-actin (F: TGACGTTGACATCCGTAAAGACC
; R: CTCAGGAGGAGCAATGATCTTGA; 148bp) (4). The standard 50 μl volume reaction contained 25 μl 2×PCR buffer, 5 μl cDNA template, 0.4 μmol/L forward and reverse primers. Quantitative real-time PCR was performed using Roche Light Cycler 480Ⅱ(Roche Diagnostics, Germany). PCR reactions were performed using a total of 45 cycles consisting of a 15 s melt at 95°C, followed by a 30 s annealing at 60°C, 30 s extension at 72°C. Each sample was analyzed in triplicate for each target gene.
References
1. Brambilla R, Dvoriantchikova G, Barakat D, Ivanov D, Bethea JR, Shestopalov VI. Transgenic inhibition of astroglial NF-kappaB protects from optic nerve damage and retinal ganglion cell loss in experimental optic neuritis. Journal of neuroinflammation. 2012;9:213.
2. Chae MJ, Sung HY, Kim EH, Lee M, Kwak H, Chae CH, et al. Chemical inhibitors destabilize HuR binding to the AU-rich element of TNF-alpha mRNA. Experimental & molecular medicine. 2009;41:824-31.
3. Wang J, Ma J, Charboneau R, Barke R, Roy S. Morphine inhibits murine dendritic cell IL-23 production by modulating Toll-like receptor 2 and Nod2 signaling. The Journal of biological chemistry. 2011;286:10225-32.
4. Mathew R, Futterweit S, Valderrama E, Tarectecan AA, Bylander JE, Bond JS, et al. Meprin-alpha in chronic diabetic nephropathy: interaction with the renin-angiotensin axis. American journal of physiology Renal physiology. 2005;289:F911-21.
Supplemental Figure legend
Supplemental Figure 1. Th17 cells are not induced in the lung after the tumor cell challenge. The mice were given antibiotics for five weeks and then challenged with B16/F10 melanoma cells (1×105 cells/mouse, i.v.) or with LLC cells (2×106 cells/mouse, i.v.). On days 17 and 21 after the B16/F10 melanoma and LLC challenge, the CD3+ αβTCR+ CD4+ T cells in the lung were analyzed by FACS to determine their cytokine production. (A) Representative dot plots are shown. (B) The percentages of IL-17A-producing CD4+ T cells were statistically analyzed. There were six mice in each group. The data are shown as the mean ± SEM. *P<0.05 compared with the control group.
Supplemental Figure 2. No significant difference in the production of IFN-γ by NK cells in the Abt mice compared with the control. The mice were given antibiotics for five weeks and then challenged with B16/F10 melanoma cells (1×105 cells/mouse, i.v.) or with LLC cells (2×106 cells/mouse, i.v.). On days 17 and 21 after the B16/F10 melanoma and LLC challenge, the NK cells in the lungs and spleen were analyzed by FACS to determine their cytokine production. (A) The CD3-NK1.1+ cells were gated, and the percentages of IFN-γ+ NK cells are shown. (B) The number of IFN-γ+ NK cells in the lungs and spleen are shown. There were six mice in each group. The data are shown as the mean ± SEM. *P<0.05 compared with the control group.
3